> Procedures > Therapeutic or Preventive Procedure > Ligation

Ligation

Ligation is the process of binding two or more molecules together, often used in molecular biology and genetic engineering.
This technique allows researchers to join DNA fragments, create recombinant plasmids, and construct genetically modified organisms.
Ligation is a critical step in many cloning and gene manipulation procedures, as it enables the incorporation of desired genetic sequences into target vectors.
Efficient and accurate ligation is essential for ensuring the success of downstream experiments and maintaining the integrity of the final construct.
Careful optimization of ligation protocols, including the selection of appropriate enzymes, buffers, and reaction conditions, is crucial for maximizing yield and minimnizing errors.
The PubCompare.ai tool can help researchers locate the best ligation protocols from published literature, preprints, and patents, and enhance the reproducibiltiy and accuracy of their ligation-based experiments.

Most cited protocols related to «Ligation»

High-Throughput Chromatin Conformation Capture

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2014

Cell Lines Cell Nucleus Cells Formaldehyde Ligation Microtubule-Associated Proteins Nucleotides Streptavidin Technique, Dilution

Comprehensive Hi-C Data Analysis Pipeline

HiC-Pro is organized into four distinct modules following the main steps of Hi-C data analysis: (i) read alignment, (ii) detection and filtering of valid interaction products, (iii) binning and (iv) contact map normalization (Fig. 3).Fig. 3

HiC-Pro workflow. Reads are first aligned on the reference genome. Only uniquely aligned reads are kept and assigned to a restriction fragment. Interactions are then classified and invalid pairs are discarded. If phased genotyping data and N-masked genome are provided, HiC-Pro will align the reads and assign them to a parental genome. For the Hi-C protocol based on restriction enzyme digestion, the read pairs will then be assigned to a restriction fragment and invalid ligation products will be filtered out. These first steps can be performed in parallel for each read chunk. Data from multiple chunks are then merged and binned to generate a single genome-wide interaction map. For allele-specific analysis, only pairs with at least one allele-specific read are used to build the contact maps. The normalization is finally applied to remove Hi-C systematic bias on the genome-wide contact map. MAPQ Mapping Quality , PE paired end

Servant N., Varoquaux N., Lajoie B.R., Viara E., Chen C.J., Vert J.P., Heard E., Dekker J, & Barillot E. (2015). HiC-Pro: an optimized and flexible pipeline for Hi-C data processing. Genome Biology, 16, 259.

Full text: Click here

Publication 2015

Alleles Digestion DNA Restriction Enzymes Genome Ligation Microtubule-Associated Proteins Parent

Single-Strand DNA Library for Ancient Genomics

DNA libraries for sequencing are normally prepared from double-stranded DNA (Fig. 1). However, for ancient DNA the use of single-stranded DNA may be advantageous as it will double its representation in the library. Furthermore, in a single-stranded DNA library, double-stranded molecules that carry modifications on one strand that prevent their incorporation into double-stranded DNA libraries could still be represented by the unmodified strand. We therefore devised a single-stranded library preparation method wherein the ancient DNA is dephosphorylated, heat denatured, and ligated to a biotinylated adaptor oligonucleotide, which allows its immobilization on streptavidin-coated beads (Fig. 1). A primer hybridized to the adaptor is then used to copy the original strand with a DNA polymerase. Finally, a second adaptor is joined to the copied strand by blunt-end ligation and the library molecules are released from the beads. The entire protocol is devoid of DNA purification steps, which inevitably cause loss of material.
We applied this method to aliquots of the two DNA extracts (as well as side fractions) that were previously generated from the 40 mg of bone that comprised the entire inner part of the phalanx (2 (link), 8 ). Comparisons of these newly generated libraries to the two libraries generated in the previous study (2 (link)) show at least a 6-fold and 22-fold increase in the recovery of library molecules (8 ), which is particularly pronounced for longer molecules (Fig. S4).
In addition to improved sequence yield, the single-strand library protocol reveals new aspects of DNA fragmentation and modification patterns (8 ). Since the ends of both DNA strands are left intact, it reveals that strand breakage occurs preferentially before and after guanine residues (Fig. S6), suggesting that guanine nucleotides are frequently lost from ancient DNA, possibly as the result of depurination. It also reveals that deamination of cytosine residues occurs with almost equal frequencies at both ends of the ancient DNA molecules. Since deamination is hypothesized to be frequent in single-stranded DNA overhangs (9 (link), 10 (link)), this suggests that 5′- and 3′-overhangs occur at similar lengths and frequencies in ancient DNA.

Meyer M., Kircher M., Gansauge M.T., Li H., Racimo F., Mallick S., Schraiber J.G., Jay F., Prüfer K., de Filippo C., Sudmant P.H., Alkan C., Fu Q., Do R., Rohland N., Tandon A., Siebauer M., Green R.E., Bryc K., Briggs A.W., Stenzel U., Dabney J., Shendure J., Kitzman J., Hammer M.F., Shunkov M.V., Derevianko A.P., Patterson N., Andrés A.M., Eichler E.E., Slatkin M., Reich D., Kelso J, & Pääbo S. (2012). A HIGH COVERAGE GENOME SEQUENCE FROM AN ARCHAIC DENISOVAN INDIVIDUAL. Science (New York, N.Y.), 338(6104), 222-226.

Publication 2012

Bones Bones of Fingers Cytosine Deamination DNA DNA, Ancient DNA, Double-Stranded DNA, Single-Stranded DNA-Directed DNA Polymerase DNA Fragmentation DNA Library Guanine Guanine Nucleotides Immobilization Ligation Oligonucleotide Primers Oligonucleotides Streptavidin

Double Digest RADseq: A Cost-Effective Genomic Profiling Method

We have developed a protocol that builds on the RADseq method [19] (link) but which differs in two principal respects (Figure 2). First, our method eliminates random shearing and end repair of genomic DNA (an advantage shared with a family of partially overlapping protocols such as MSG, CrOPS, and other recent RADseq derivatives [9] , [20] (link), [21] (link)). Instead, we use a double restriction enzyme (RE) digest (i.e., a restriction digest with two enzymes simultaneously) that results in at least five-fold reduction in library production cost–complete ddRADseq libraries cost ∼$5 per sample, while the necessary enzymatic steps following the initial restriction digest and ligation in random shearing RAD libraries alone introduce a cost of ∼$25 per library (NEB, Ipswich, MA). Furthermore, the elimination of several high-DNA-loss steps permits construction of ddRAD libraries from 100 ng or less of starting DNA. Second, we introduced a precise selection for genomic fragments by size, which allows greater fine-scale control of the fraction of regions represented in the final library (see results). By combining precise and repeatable size selection with sequence-specific fragmentation, double digest Restriction-Site Associated DNA sequencing (ddRADseq) produces sequencing libraries consisting of only the subset of genomic restriction digest fragments generated by cuts with both REs (i.e., have one end from each cut) and which fall within the size-selection window (Figure 2B). This combination of requirements can be tuned to generate libraries consisting of fragments derived from hundreds to hundreds of thousands of regions genome-wide.
Precise, repeatable size selection offers two further advantages. First, because only a small fraction of restriction fragments will fall in the target size-selection regime (<5% in conditions described here), the probability of sampling both directions from the same restriction site is low. This reduces “duplicate” (i.e., immediately neighboring) region sampling, which effectively halves the number of reads that are required to reach high-confidence sampling of a SNP associated with a given RE cut site. Second, shared bias in region representation favoring fragments closest to the mean of size selection, in turn, biases independent samples (e.g., from different individuals) towards recovering the same genomic regions (Figure 2B). Because of this correlated recovery, regions are “filled in” with reads in approximately the same order across all individual samples, and samples with read recovery counts below saturation will still share a significant number of well-covered regions (“Experimental ddRADseq results” below; Analysis S1 Supporting Figure 4; Analysis S1 “Region recovery: ddRADseq vs. random shearing”). Both of these properties make the ddRADseq method robust to under-sampling with respect to read counts, which is a commonly observed problem arising from unequal read representation across individual samples in pooled sequencing experiments [9] , [22] (link), [23] .

Peterson B.K., Weber J.N., Kay E.H., Fisher H.S, & Hoekstra H.E. (2012). Double Digest RADseq: An Inexpensive Method for De Novo SNP Discovery and Genotyping in Model and Non-Model Species. PLoS ONE, 7(5), e37135.

Full text: Click here

Publication 2012

Crop, Avian derivatives DNA Library DNA Repair DNA Restriction Enzymes Enzymes Genome Ligation

Oligonucleotide Synthesis and CRISPR Library Cloning

Oligonucleotides were synthesized at the Broad Technology Laboratory (BTL) on a B3 Synthesizer (CustomArray). To each sgRNA sequence, BsmBI recognition sites were appended along with the appropriate overhang sequences (underlined) for cloning into sgRNA expression plasmids. Additional primer sites were appended to allow differential amplification of subsets from the same synthesis pool. The final oligonucleotide sequence was thus: 5’-[Forward Primer]CGTCTCACACCG[sgRNA, 20 nt]GTTTCGAGACG[Reverse Primer].
Unique primer sets were used to amplify individual subpools using 25 μL 2x NEBnext PCR master mix (New England Biolabs), 2 μL of oligonucleotide pool (~40 ng), 5 μL of primer mix at a final concentration of 0.5 μM, and 18 μL water. PCR cycling conditions: 30 seconds at 98°C, 30 seconds at 53°C, 30 seconds at 72°C, for 24 cycles.

Primer Set	Forward Primer, 5’ – 3’	Reverse Primer, 5’ – 3’
1	AGGCACTTGCTCGTACGACG	ATGTGGGCCCGGCACCTTAA
2	GTGTAACCCGTAGGGCACCT	GTCGAGAGCAGTCCTTCGAC
3	CAGCGCCAATGGGCTTTCGA	AGCCGCTTAAGAGCCTGTCG
4	CTACAGGTACCGGTCCTGAG	GTACCTAGCGTGACGATCCG
5	CATGTTGCCCTGAGGCACAG	CCGTTAGGTCCCGAAAGGCT
6	GGTCGTCGCATCACAATGCG	TCTCGAGCGCCAATGTGACG

The resulting amplicons were PCR-purified (Qiagen), digested with Esp3I (Fisher Scientific) and cloned into either lentiGuide (pXPR_003, Addgene 52963) or lentiCRISPRv2 (pXPR_023, Addgene 52961). The ligation product was isopropanol precipitated and electroporated into Stbl4 electrocompetent cells (Life Technologies) and grown at 30°C for 16 hours on agar with 100 μg/mL carbenicillin. Colonies were scraped and plasmid DNA (pDNA) was prepared (HiSpeed Plasmid Maxi, Qiagen). To confirm library representation and distribution, the pDNA was sequenced by Illumina. After mapping of Illumina reads (see below) we calculated the overall fraction of reads that contained intended sgRNAs, which serves as a surrogate for the quality of the oligonucleotide synthesis. By this cloning scheme, only 21 nts of the synthesized oligonucleotide, the prepended G and the 20 nt variable sequence, become incorporated in the final library, in contrast to ligation-independent cloning schemes (e.g. Gibson) in which both the sgRNA and flanking sequences are derived from synthesis. We deem a library to have passed quality control if > 85% of the sequencing reads map to an intended sgRNA, which corresponds to an oligonucleotide synthesis error rate of 0.75% per base or lower (85% = 21^1-0.0075). A distribution of sgRNA abundance for the subpools, as well as GeCKOv2 for comparison, is given in Supplementary Figure 2.

Doench J.G., Fusi N., Sullender M., Hegde M., Vaimberg E.W., Donovan K.F., Smith I., Tothova Z., Wilen C., Orchard R., Virgin H.W., Listgarten J, & Root D.E. (2016). Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nature biotechnology, 34(2), 184-191.

Publication 2015

Agar Anabolism Carbenicillin Cells DNA Library Isopropyl Alcohol Ligation Neoplasm Metastasis Oligonucleotide Primers Oligonucleotides Plasmids

Most recents protocols related to «Ligation»

Reversing Analyte Orientation in Nucleic Acid Libraries

Not available on PMC !

Example 4

FIGS. 5A-B show an exemplary nucleic acid library method to reverse the orientation of an analyte sequence in a member of a nucleic acid library. FIG. 5A shows an exemplary member of a nucleic acid library including, in a 5′ to 3′ direction, a ligation sequence, a barcode (e.g., a spatial barcode or a cell barcode), unique molecular identifier, a reverse complement of a first adaptor, an amplification domain, a capture domain, a sequence complementary to an analyte, and a second adapter.

The ends of the double-stranded nucleic acid can be ligated together via a ligation reaction where the ligation sequence splints the ligation to generate a circularized double-stranded nucleic acid also shown in FIG. 5A.

The circularized double-stranded nucleic acid can be amplified to generate a linearized double-stranded nucleic acid product, where the orientation of the analyte is reversed such that the 5′ sequence (e.g., 5′ UTR) is brought in closer proximity to the barcode (e.g., a spatial barcode or a cell barcode) (FIG. 5B). The first primer includes a sequence substantially complementary to the reverse complement of the first adaptor and a functional domain. The functional domain can be a sequencer specific flow cell attachment sequence (e.g., P5). The second primer includes a sequence substantially complementary to the amplification domain.

The resulting double-stranded member of the nucleic acid library including a reversed analyte sequence (e.g., the 5′ end of the analyte sequence is brought in closer proximity to the barcode) can undergo standard library preparation methods, such as library preparation methods used in single-cell or spatial analyses. For example, the double-stranded member of the nucleic acid library lacking all, or a portion of, the sequence encoding the constant region of the analyte can be fragmented, followed by end repair, A-tailing, adaptor ligation, and/or amplification (e.g., PCR) (FIG. 5C). The fragments can then be sequenced using, for example, paired-end sequencing using TruSeq Read 1 and TruSeq Read 2 as sequencing primer sites, or any other sequencing method described herein.

As a result of the methods described in this Example, sequences from the 5′ end of an analyte will be included in sequencing libraries (e.g., paired end sequencing libraries). Any type of analyte sequence in a nucleic acid library can be prepared by the methods described in this Example (e.g., reversed).

US11859178B2. Nucleic acid library methods (2024-01-02). 10x Genomics, Inc. [US]. Inventors: Caroline Julie Gallant [SE], Marlon Stoeckius [SE], Katherine Pfeiffer [US].

Full text: Click here

Patent 2024

5' Untranslated Regions Cell-Matrix Junction Cells DNA Library Ligation Nucleic Acids Oligonucleotide Primers Splints Standard Preparations

Variceal Tissue Ligation Band

Not available on PMC !

Example 3

FIG. 7 illustrates an embodiment of a ligation band 200, similar to the band 100 discussed above, with first and second tissue-contacting surfaces 220, 230 and tissue-gripping features 250, similar to the surfaces 120, 130 and the features 150. The figure illustrates the pressure being applied by the band 200 and the first and second surfaces 220, 230 to sandwich or secure trapped variceal tissue 260 therebetween, while the tissue-gripping features 250 provide extra anti-slip friction to lock or secure the variceal tissue 260 into place.

US11871930B2. Anti-slip ligation bands (2024-01-16). United States Endoscopy Group, Inc. [US], None [US], None [US]. Inventors: Melissa Clark [US], Fritz Haller [US].

Full text: Click here

Patent 2024

Friction Ligation Pressure Tissues

Proof-of-Concept Microarray Assay Validation

Not available on PMC !

Example 1

As an initial proof of concept, a model system is developed using a microarray to demonstrate a working single-plex assay. The basic design validates the concept of the assay, and establishes a working assay prior to addressing issues related to the analysis of a more complicated biological sample. Conventional sequencing is used as a readout for this proof of concept.

A microarray is used as a proxy for a tissue section. The target sequences of the microarray are fully specified, so that the composition of the targets are known and can be varied systematically. Synthetic oligonucleotide templates are attached to a glass slide via a 5′ amino modification. Each slide has a single oligonucleotide template sequence, and the assays that are carried out may employ either ligation, or extension followed by ligation as this may be useful in determining certain polymorphisms.

Once the in situ part of the assay is complete, the reaction products are eluted and analyzed by qPCR to determined presence or absence of a product and estimate yield, and by conventional sequencing to determine the structure of the assay products. The single plex assays that are tested include appropriate positive and negative controls, and a single nucleotide variant (SNV) to check ability to discriminate single base variants.

US11866770B2. Spatially encoded biological assays (2024-01-09). Prognosys Biosciences, Inc. [US]. Inventors: Mark S. Chee [US].

Full text: Click here

Patent 2024

Biological Assay Biological Models Biopharmaceuticals Genetic Polymorphism Ligation Microarray Analysis Nucleotides Oligonucleotides Tissues

Optimizing Tri-TAC Design for Enhanced T Cell Functionality

Not available on PMC !

Example 3

FIG. 10A-FIG. 10B illustrate several TAC variants with different linkers connecting the ligand that binds a TCR complex and the target-binding ligand domain. The flexible connector allows movement between the two domains. The large domain connector contains two folded domains and is very large and rigid. The small and long helix connectors also introduce rigidity but are less restrictive when compared to the large domain linker.

FIG. 11A-FIG. 11E illustrate the impact of connector substitution on Tri-TAC surface expression, Tri-TAC transduction efficiency, and cytokine production upon Tri-TAC ligation. FIG. 11A and FIG. 11B show that the helical linkers enhance surface expression and transduction efficiency when compared to the flexible linker, while the large domain connector enhances transduction efficiency but not surface expression. FIG. 11D, FIG. 11E illustrates cytokine production by cells expressing Tri-TACs with short helix, long helix, or large domain connectors.

FIG. 12A illustrates enhanced in vitro cytotoxicity of T cells expressing Tri-TACs with the short helix connector. FIG. 12B illustrates enhanced in vivo tumor control of T cells expressing Tri-TACs with the short helix connector. The short helical connector was associated with high in vitro cytotoxicity and effective in vivo tumor control.

US11878035B2. T cell-antigen coupler with various construct optimizations (2024-01-23). Triumvira Immunologics USA, Inc. [US], McMaster University [CA]. Inventors: Jonathan Lorne Bramson [CA], Christopher W. Helsen [CA], Joanne Alicia Hammill [CA], Kenneth Anthony Mwawasi [CA].

Full text: Click here

Patent 2024

Cells Cytokine Cytotoxic T-Lymphocytes Cytotoxin Helix (Snails) Ligands Ligation Movement Muscle Rigidity Neoplasms T-Lymphocyte

Optimizing Targeted Molecular Probe Avidity

Not available on PMC !

Example 14

Eight NH₂—PEG_n-RGD peptides containing spacers of various PEG lengths (n=2, 4, 6, 8, 10, 12, 14, 16) will be prepared by adding the corresponding Boc-PEG_n-NHS to RGD in a PBS buffer (pH=8.2), followed by Boc deprotection. Photo-ODIBO-NHS, prepared using previously reported procedures, will then be mixed with the prepared NH₂—PEG_n-RGD in a PBS buffer (pH=8.2) to produce photo-OIDBO-PEG_n-RGD. N₃-PEG₄-cetuximab will be prepared using previously reported procedures. N₃—PEG₄-cetuximab and the eight photo-ODIBO-PEG_n-RGD peptides (n=2, 4, 6, 8, 10, 12, 14, 16) will be used for in vitro screening (at 4° C. to minimize the internalization of targeting probes). As shown in FIG. 11: 1): eight mixed-ligands stock solutions will be prepared by mixing N₃-PEG₄-cetuximab with one of the eight photo-OIDBO-PEG_n-RGD peptides; 2) U87MG cells will be cultured in a 96-well plate; 3) one of the above eight mixed-ligands stock solution will be added into each well (eight wells in total) pre-seeded with U87MG; 2) after the ligands bind to the targeted receptors, the excess (unbound) targeting ligands will be washed off using a PBS buffer (repeated 5 times to ensure complete removal); 3) a UV lamp (365 nm) will be applied to deprotect the azide-inactive photo-ODIBO and generate azide-active “ODIBO”, subsequently triggering ligation between the N₃-PEG₄-cetuximab and ODIBO-PEG_n-RGD; 4) after being incubated for an additional 2 h, ⁶⁴Cu-labeled N₃—NOTA will be added to click with the “excess” ODIBO-PEG_n-RGD (that binds to cells, but does not click to N₃-PEG₄-cetuximab); and 5) the excess N₃-(⁶⁴Cu)NOTA will be removed, and the N₃-(⁶⁴Cu)NOTA clicked to “excess” ODIBO-PEG_n-RGD will be measured on MicroBeta2 Plate Counter. One group without UV irradiation will be used as a negative control to get counts from the non-specific binding of N₃-(⁶⁴Cu)NOTA. After subtracting the non-specific binding, the specific binding of N₃-(⁶⁴Cu)NOTA obtained from the eight ODIBO-PEG_n-RGD (n=2, 4, 6, 8, 10, 12, 14, 16) will be compared. The well with the lowest specific binding will contain the highest amount of clicking product (between cetuximab-PEG₄-N₃and ODIBO-PEG_n-RGD), thus the corresponding spacer will be the most potent.

The ODIBO-PEG_n-RGD containing the most potent PEG spacer will click with Tz-NOTA-N₃and then be radiolabeled with ⁶⁴Cu, and the resulting Tz-(⁶⁴Cu)NOTA-PEG_n-RGD will be used for the in vitro avidity studies on U87MG cells. Tz-(⁶⁴Cu)NOTA-RGD (without a PEG spacer) will be used as a negative control because the distance between RGD and cetuximab in the resulting heterodimer is too short to achieve avidity effect (proved in preliminary study, FIG. 5B). Briefly, Tz-(⁶⁴Cu)NOTA-PEG_n-RGD/TCO-PEG₄-cetuximab ligation product (cetuximab-PEG₄-(⁶⁴Cu)NOTA-PEG_n-RGD) will be used for cell uptake/efflux, binding affinity and Bmax measurements on U87MG cells. After high avidity effect is confirmed on the above ligation product, in vivo evaluation will be performed then. Mice bearing U87MG xenografts will be pre-injected with 100 μg of TCOPEG₄-cetuximab, and 24 h later, ˜250-350 pCi of Tz-(⁶⁴Cu)NOTA-PEG_n-RGD (or Tz-(⁶⁴Cu)NOTA-RGD in the negative control group) will be injected. Then 1 h dynamic PET scans will be performed at multiple time points (p.i., 4, 18, and/or 28 h). As cetuximab is cleared through the liver, kinetics on tumor and liver at mid and late time points can be evaluated. At mid/late time points (4, 18, 28 h) when most of the un-ligated Tz-(⁶⁴Cu)NOTAPEGn-RGD has been washed off, observation of relatively slower tumor washing out and faster liver clearing (compared to that from Tz-(⁶⁴Cu)NOTA-RGD) can indicate the much stronger binding with tumor cells, and thus an avidity effect of in vivo ligation product (cetuximab-PEG₂-(⁶⁴Cu)NOTA-PEG_n-RGD) is being achieved.

Various references are cited in this document, which are hereby incorporated by reference in their entireties herein.

US11857648B2. Dimerization strategies and compounds for molecular imaging and/or radioimmunotherapy (2024-01-02). UNIVERSITY OF PITTSBURGH—OF THE COMMONWEALTH SYSTEM OF HIGHER EDUCATION [US]. Inventors: Dexing Zeng [US], Lingyi Sun [US], Yongkang Gai [US].

Full text: Click here

Patent 2024

1,4,7-triazacyclononane-N,N',N''-triacetic acid Azides Buffers Cells Cetuximab Heterografts Kinetics Ligands Ligation Liver Mus Neoplasms Peptides Positron-Emission Tomography Ultraviolet Rays

Top products related to «Ligation»

Agilent 2100 bioanalyzer by Agilent Technologies

Sourced in United States, Germany, Canada, China, France, United Kingdom, Japan, Netherlands, Italy, Spain, Australia, Belgium, Denmark, Switzerland, Singapore, Sweden, Ireland, Lithuania, Austria, Poland, Morocco, Hong Kong, India

The Agilent 2100 Bioanalyzer is a lab instrument that provides automated analysis of DNA, RNA, and protein samples. It uses microfluidic technology to separate and detect these biomolecules with high sensitivity and resolution.

T4 dna ligase by New England Biolabs

Sourced in United States, China, United Kingdom, Germany, Japan, France, Canada, Morocco, Switzerland, Australia

T4 DNA ligase is an enzyme that catalyzes the formation of phosphodiester bonds between adjacent 3'-hydroxyl and 5'-phosphate termini in DNA. It is commonly used in molecular biology for the joining of DNA fragments.

Hiseq 2500 by Illumina

Sourced in United States, China, Germany, United Kingdom, Canada, Switzerland, Sweden, Japan, Australia, France, India, Hong Kong, Spain, Cameroon, Austria, Denmark, Italy, Singapore, Brazil, Finland, Norway, Netherlands, Belgium, Israel

The HiSeq 2500 is a high-throughput DNA sequencing system designed for a wide range of applications, including whole-genome sequencing, targeted sequencing, and transcriptome analysis. The system utilizes Illumina's proprietary sequencing-by-synthesis technology to generate high-quality sequencing data with speed and accuracy.

Hiseq 2000 by Illumina

Sourced in United States, China, Germany, United Kingdom, Hong Kong, Canada, Switzerland, Australia, France, Japan, Italy, Sweden, Denmark, Cameroon, Spain, India, Netherlands, Belgium, Norway, Singapore, Brazil

The HiSeq 2000 is a high-throughput DNA sequencing system designed by Illumina. It utilizes sequencing-by-synthesis technology to generate large volumes of sequence data. The HiSeq 2000 is capable of producing up to 600 gigabases of sequence data per run.

Trizol reagent by Thermo Fisher Scientific

Sourced in United States, China, Japan, Germany, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Netherlands, Belgium, Lithuania, Denmark, Singapore, New Zealand, India, Brazil, Argentina, Sweden, Norway, Austria, Poland, Finland, Israel, Hong Kong, Cameroon, Sao Tome and Principe, Macao, Taiwan, Province of China, Thailand

TRIzol reagent is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components designed for the isolation of total RNA, DNA, and proteins from a variety of biological samples. The reagent maintains the integrity of the RNA while disrupting cells and dissolving cell components.

Ampure xp bead by Beckman Coulter

Sourced in United States, United Kingdom, Germany, Canada, France, Australia, China, Japan, Italy, Switzerland, Netherlands

AMPure XP beads are a magnetic bead-based product used for the purification of nucleic acids, such as DNA and RNA, from various samples. The beads are designed to selectively bind to nucleic acids, allowing for the removal of contaminants and unwanted molecules during the purification process. The core function of AMPure XP beads is to provide an efficient and reliable method for the cleanup and concentration of nucleic acids in preparation for downstream applications.

2100 bioanalyzer by Agilent Technologies

Sourced in United States, Germany, Canada, United Kingdom, France, China, Japan, Spain, Ireland, Switzerland, Singapore, Italy, Australia, Belgium, Denmark, Hong Kong, Netherlands, India

The 2100 Bioanalyzer is a lab equipment product from Agilent Technologies. It is a microfluidic platform designed for the analysis of DNA, RNA, and proteins. The 2100 Bioanalyzer utilizes a lab-on-a-chip technology to perform automated electrophoretic separations and detection.

T4 dna ligase by Thermo Fisher Scientific

Sourced in United States, Germany, China, Lithuania, Canada, Spain, France, United Kingdom, Denmark, Netherlands, India, Switzerland, Hungary

T4 DNA ligase is an enzyme used in molecular biology and genetics to join the ends of DNA fragments. It catalyzes the formation of a phosphodiester bond between the 3' hydroxyl and 5' phosphate groups of adjacent nucleotides, effectively sealing breaks in double-stranded DNA.

Novaseq 6000 by Illumina

Sourced in United States, China, United Kingdom, Japan, Germany, Canada, Hong Kong, Australia, France, Italy, Switzerland, Sweden, India, Denmark, Singapore, Spain, Cameroon, Belgium, Netherlands, Czechia

The NovaSeq 6000 is a high-throughput sequencing system designed for large-scale genomic projects. It utilizes Illumina's sequencing by synthesis (SBS) technology to generate high-quality sequencing data. The NovaSeq 6000 can process multiple samples simultaneously and is capable of producing up to 6 Tb of data per run, making it suitable for a wide range of applications, including whole-genome sequencing, exome sequencing, and RNA sequencing.

Nextseq 500 by Illumina

Sourced in United States, Germany, China, United Kingdom, Australia, France, Italy, Canada, Japan, Austria, India, Spain, Switzerland, Cameroon, Netherlands, Czechia, Sweden, Denmark

The NextSeq 500 is a high-throughput sequencing system designed for a wide range of applications, including gene expression analysis, targeted resequencing, and small RNA discovery. The system utilizes reversible terminator-based sequencing technology to generate high-quality, accurate DNA sequence data.

What are the common challenges faced when performing ligation reactions?

Ligation reactions can be tricky to optimize, with common challenges including achieving the right DNA fragment ratios, ensuring appropriate enzyme activity, and avoiding unwanted side-reactions. Factors like buffer composition, incubation time, and temperature can all impact ligation efficiency and accuracy. Careful protocol selection and optimization is crucial for successful ligation-based experiments.

How can PubCompare.ai help with ligation protocol optimization?

PubCompare.ai is a powerful tool that can assist researchers in optimizing their ligation protocols. The platform allows you to efficiently screen the literature to identify the most effective ligation methods for your specific needs. Using advanced AI and machine learning, PubCompare.ai can highlight key differences in protocol effectiveness, enzyme selection, buffer compositions, and other critical insights to help you choose the best approach. This can greatly enhance the reproducibility and accuracy of your ligation-based experiments.

What are the different types or variations of ligation techniques?

Ligation techniques can vary depending on the specific application and DNA/RNA fragments involved. Common ligation methods include sticky-end ligation, blunt-end ligation, cohesive-end ligation, and homologue-based ligation. Each approach has its own advantages and limitations, and the choice of technique will depend on factors such as the available restriction sites, fragment compatibility, and the desired final construct. PubCompare.ai can help researchers identify the most suitable ligation method for their project by comparing the performance of different techniques reported in the literature.

How can PubCompare.ai help researchers find the best ligation protocols from published literature?

PubCompare.ai's AI-powered platform allows researchers to efficiently screen through the vast amount of published ligation protocol literature, including journal articles, preprints, and patents. The tool's machine learning algorithms can quickly identify the most effective ligation methods, highlighting key differences in factors like enzyme selection, buffer composition, and reaction conditions. This empowers researchers to make informed decisions and choose the ligation protocol that best suits their specific needs, improving the reproducibility and accuracy of their experiments. The platform's user-friendly interface makes it easy to compare and contrast ligation protocols, saving time and enhancing research productivity.

What are some common applications of ligation in molecular biology and genetic engineering?

Ligation is a critical technique used in a wide range of molecular biology and genetic engineering applications. Some of the most common uses include: 1. DNA cloning: Ligation is used to insert desired DNA fragments into plasmid vectors, enabling the creation of recombinant DNA constructs. 2. Genetic modification: Ligation allows the incorporation of foreign genetic material into host organisms, facilitating the development of genetically modified organisms (GMOs). 3. Sequencing library preparation: Ligation is employed to attach adapter sequences to DNA fragments, enabling high-throughput sequencing. 4. Plasmid construction: Ligation is used to assemble multiple DNA fragments into a single plasmid, allowing for the creation of complex genetic constructs. PubCompare.ai can help researchers optimize ligation protocols for these and other applications, ensuring the success of their molecular biology experiments.

More about "Ligation"

Ligation is the fundamental process of joining DNA fragments together, which is essential for a wide range of molecular biology and genetic engineering applications.
This critical technique allows researchers to create recombinant plasmids, construct genetically modified organisms, and incorporate desired genetic sequences into target vectors.
The success of downstream experiments, such as cloning and gene manipulation procedures, is heavily dependent on efficient and accurate ligation.
Optimizing ligation protocols is crucial to maximize yield and minimize errors.
Careful selection of enzymes, buffers, and reaction conditions is key.
Commonly used enzymes include T4 DNA ligase, which catalyzes the formation of phosphodiester bonds between DNA fragments.
The Agilent 2100 Bioanalyzer and 2100 Bioanalyzer are often used to assess the quality and integrity of DNA samples before and after ligation.
Advancements in high-throughput sequencing technologies, such as the HiSeq 2500, HiSeq 2000, NovaSeq 6000, and NextSeq 500, have greatly expanded the scope of ligation-based applications.
These platforms enable researchers to analyze and manipulate genetic material on a larger scale, further emphasizing the importance of reliable ligation protocols.
Sample preparation steps, including the use of TRIzol reagent and AMPure XP beads, can also impact the efficiency and accuracy of ligation.
By leveraging the power of AI-driven tools like PubCompare.ai, researchers can quickly locate the best ligation protocols from published literature, preprints, and patents, enhancing the reproducibility and quality of their ligation-based experiments.