Total RNA was isolated from sorted cells using TRIzol reagent (Invitrogen) per the manufacturer’s instructions. Genomic DNA was eliminated using DNase (Promega). The purity and concentration of RNA was quantified using a Nanodrop spectrophotometer (ThermoFisher Scientific). The reverse transcription of RNA (1 μg/sample) was performed using an iScript cNDA Synthesis kit (Bio-Rad) per the manufacturer’s instructions. Quantitative reverse transcription polymerase chain reaction (qRT-PCR) was conducted using SYBR Green Real-Time PCR Master Mixes (ThermoFisher Scientific) and a StepOnePlus Real-Time PCR System (Applied Biosystems). The results were normalized with glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and fold changes were calculated with the formula 2−ΔΔCT. The primer sequences used for qRT-PCR are listed as follows (from the 5′ end to 3′ end): Klf1 (forward-TACACCAAGAGCTCGCACC; reverse-TGGTCAGAGCGTGAAAAAGC), Nfe2 (forward-CTCCTCAGCAGAACAGGAACA; reverse-GCAATATGTTGGAGGTGGCAG), Gfi1b (forward-GTTGCTGAACCAGAGCCTTC; reverse-GGGGGTCTGTGTGTAGCTGT), and GAPDH (forward-TCAACAGCAACTCCCACTCTTCCA; reverse-ACCCTGTTGCTGTAGCCGTATTCA).
Iscript cnda synthesis kit
Manufactured by Bio-Rad
The IScript cDNA Synthesis kit is a laboratory tool designed to generate complementary DNA (cDNA) from RNA samples. The kit provides the necessary reagents and protocols to perform reverse transcription, a process that converts RNA into single-stranded cDNA molecules. This cDNA can then be used as a template for various downstream applications, such as gene expression analysis, quantitative PCR, or next-generation sequencing.
Automatically generated - may contain errors
Lab products found in correlation
Nanodrop spectrophotometer, by Thermo Fisher Scientific (4 mentions)
Sybr green real time pcr master mixes, by Thermo Fisher Scientific (1 mentions)
Dnase, by Promega (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (1 mentions)
Purelink total rna purification system, by Thermo Fisher Scientific (1 mentions)
Cfx96 real time detection system, by Bio-Rad (1 mentions)
2 protocols using iscript cnda synthesis kit
1
Quantitative RNA Expression Analysis
2
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with the PureLink total RNA purification system using the on‐column DNase protocol (Life Technologies Inc) according to manufacturer's instructions. RNA concentration and purity were determined with a NanoDrop spectrophotometer (Thermo Fisher Scientific) in duplicate. For quantitative reverse transcriptase PCR, 500 ng of total RNA was reverse transcribed using the iScript cNDA synthesis kit (Bio‐Rad). A reaction mixture of 12.5 ng of reverse‐transcribed cDNA, DNMT1 forward primer (TGCCAGCTGAGCGTGGTGGT), DNMT1 reverse primer (GCATGCGGGCAGCCACCAAT), and FastStart SYBR Green (Roche Applied Sciences) underwent quantitative reverse transcriptase PCR on a CFX96 Real‐Time Detection System (Bio‐Rad). Expression was normalized to β2‐microglobulin (forward 5′‐AGCATTCGGGCCGAGATGTCT‐3′, reverse 5′‐CTGCTGGATGACGTGAGTAAACCT‐3′), which is endogenously expressed and is not altered by many stimuli including shear stress.36 Normalized expression was quantified using the comparative 2ΔΔCt method.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!