Pcdh cmv ef1 gfp puro

An hsa-miR-33a-containing flank region was amplified from human genomic DNA and inserted into pCDH-CMV-EF1-GFP+puro (System Biosciences). The entire lengths of the 3′UTRs of ADAM9 and ROS1 were cloned into the pMIR-REPORT miRNA Expression Reporter Vector (Ambion). To generate a miR-33a-expressing stable cell line, a lentivirus-mediated packaging system containing four plasmids, pCDH-miR-33a or control plasmid, pMDL, REV, and VSVG, was used. To stably knock down miR-33a in MCF-7 cells, pLL3.7-puro containing anti-miR-33a or anti-pre-miR-33a shRNA was co-transfected with pMDL, REV, and VSVG. The transfection and lentiviral infection processes were similar to those previously described (Fang et al., 2011 (link)).

pEF1-A20-wt was a gift from Dr Daniel Krappmann (Helmholtz Zentrum Munchen Gmbh, German). The pCSII-H1-PGK- puro-WPRE-shRNA-A20 and control scramble vector were kindly provided by Prof. Masao Seto. pBabe-puro-flag-twist1 was kindly provided by Prof. Alain Puisieux. Lentivirus vector pCDH-CMV-EF1-GFP-puro purchased from System Biosciences was constructed for A20 stable expression. The IκBα plasmid and the NFκB promoter-luciferase plasmid were purchased from the Addgene.

An hsa-miR-27b-containing flank region was amplified from human genomic DNA and inserted into pCDH-CMV-EF1-GFP+puro (System Biosciences). The entire lengths of the 3’UTRs of NR2F2 were cloned into the pMIR-REPORT miRNA Expression Reporter Vector (Ambion). To generate a miR-27b-expressing stable cell line, a lentivirus-mediated packaging system containing four plasmids, pCDH-miR-27b or control plasmid, pMDL, REV, and VSVG, was used. To knock down miR-27b in GES-1 cells, miR-27b inhibitor was used GenePharma Colone Primer sequences were as follows: miR-27b Fw-GC TCTAGA TTGCCAGGGATTACCACGCAA; Rv-CG GGATCC CTAGCATTCCCAGCAGGAGACAG NR2F2; 3′UTR Fw-CG ACGCGT AAGAAGGGGGAGTGAAACAGAG; Rv-CCC AAGCTT AGCAAGTTGTTCTGACCGACA.