β actin hs99999903 m1

Real-time RT-PCR was performed using TaqMan gene expression assays: STAT6 Hs00598625_m1; GAPDH Hs99999905_m1; β-actin Hs99999903_m1 (Life Technologies). The expression of each test gene was normalised against expression of housekeeping genes, GAPDH & β-actin. Quantification was performed using a standard curve of recombinant human STAT6 and results expressed as absolute values or percentage STAT6 mRNA remaining. Percent mRNA remaining was calculated by multiplying the fold change value, derived using the method described by Pfaffl et al[23] , by 100.

Total RNA was isolated using QiaZOL lysis (Qiagen, Valencia, CA, USA), and further purified using Qiagen RNeasy columns. cDNA was prepared from RNA by ImProm-II Reverse Transcription System (Promega, Madison, WI, USA). Quantitative PCR for mouse LincRNA-p21 (FAM probe TGGCCAAACACTGGTG, forward primer GAAGCTTCCTTGGTGTAGATCAAAA, reverse primer CCACACCAGGTAGAAACTACGAAA) and human LincRNA-p21 (FAM probe ATGCGGCCTTGCAGG, forward primer CCCGGGCTTGTCTTTTGTT, reverse primer GAGTGGGTGGCTCACTCTTCTG) was performed using Custom TaqMan Gene Expression Assays (Life Technolgies).^{31 (link)} Additional mouse TaqMAN RT-PCR assays include p53 Mm441964_g1, Gapdh Mm99999915_g1, β-Actin Mm00607939_s1, Noxa Mm00451763_m1, Atf2 Mm00833804_g1, Survivin Mm00599749_m1, Mcl1 Mm00725832_s1, Bax Mm00432051_m1. Puma Mm00519268_m1, Cdkn1a Mm00432448_m1 and Stat3 Mm01219775_m1. Additional human TaqMAN RT-PCR assays include GAPDH Hs33929097_g1, β-Actin Hs99999903_m1, NOXA Hs00560402_m1, ATF2 Hs01095345_m1, CDKN1A Hs00355782_m1 and STAT3 Hs01047580_m1 (Life Technologies). TaqMan Gene Expression Assays were used in combination with FastStart Universal Probe Master Mix (Roche). Data were analyzed using the comparative ΔΔC_T method.

The changes in the expression of metalloproteinase‐9, transforming growth factor β1 (TGF‐β1), collagen I, disintegrin and metalloproteinase domain‐containing protein 33 (ADAM33), chitinase‐3‐like protein 1 (YKL‐40), relaxin/insulin‐like family peptide receptor 1 (RXFP1), leukotriene C4 synthase (LTC4S) and alpha‐SM‐actin (α‐SMA) were assessed utilizing qPCR. TaqMan gene expression assays were used for the selected genes: MMP‐9—Hs00957562_m1, TGF‐β1—Hs00998133_m1, collagen I—Hs00164004_m1, ADAM33—Hs00905552_m1, YKL‐40—Hs01072228_m1, RXFP1—Hs01073145_m1, LTC4S—Hs01073145_m1, α‐SMA—Hs05005339_m1, and β‐actin—Hs99999903_m1 (Life Technologies, Carlsbad, CA). Each sample was measured in triplicate using the TaqMan analyzer, and the 2^−ΔΔCt method was used to calculate gene expression. The results were normalized to an endogenous reference gene (β‐actin—Hs99999903_m1). LTC4 synthase was evaluated as an inflammation marker and α‐SMA—as fibroblast‐myofibroblasts transformation marker. By comparing RQ (relative quantification, 2^−ΔΔCt), the fold change in mRNA expression was calculated.