Overnight stationary cells were inoculated into 3 ml LB + Sm medium, grown at 37°C until mid-late exponential phase (OD 600 0.5–0.8), harvested and total RNA extracted with TRIzol reagent (Life Technologies). RNA was treated with Turbo DNase I for 30 min (Life Technologies) and subjected to qRT-PCR as previously described [71 (link)]. Briefly, 1 μg total RNA was used for the reverse transcription reaction with Superscript III first strand synthesis system with random hexamers (Life Technologies). The synthesized cDNA was subjected to real time-PCR amplification using the Fast SYBR Green Master Mix kit (Life Technologies) on the StepOnePlus platform (Life Technologies) using primers shown in S6 Table . The amplification data was analyzed by ΔΔCT method utilizing rpoC mRNA as internal control.
Steponeplus platform
Manufactured by Thermo Fisher Scientific
Sourced in United States
The StepOnePlus platform is a real-time PCR system designed for a wide range of applications in molecular biology research. It provides accurate, reliable, and efficient performance for real-time quantitative PCR (qPCR) analysis.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (10 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (5 mentions)
Mirneasy mini kit, by Qiagen (5 mentions)
Rneasy mini kit, by Qiagen (4 mentions)
Quantitect reverse transcription kit, by Qiagen (4 mentions)
Tb green premix ex taq 2 kit, by Takara Bio (4 mentions)
Tri reagent, by Merck Group (3 mentions)
Mir x mirna first strand synthesis kit, by Takara Bio (3 mentions)
Primescript rt reagent kit, by Takara Bio (3 mentions)
Nd 100 spectrophotometer, by Thermo Fisher Scientific (3 mentions)
Superscript 2, by Thermo Fisher Scientific (3 mentions)
Rneasy kit, by Qiagen (3 mentions)
Fast sybr green master mix kit, by Thermo Fisher Scientific (2 mentions)
Superscript 3 first strand synthesis system with random hexamers, by Thermo Fisher Scientific (2 mentions)
Turbo dnase 1, by Thermo Fisher Scientific (2 mentions)
Taqman universal pcr master mix, by Thermo Fisher Scientific (2 mentions)
Sybr premix ex taq dye, by Takara Bio (2 mentions)
Nanodrop, by Eppendorf (2 mentions)
Sybr green assay, by Thermo Fisher Scientific (2 mentions)
Iscript reverse transcriptase kit, by Bio-Rad (2 mentions)
47 protocols using steponeplus platform
1
Quantitative RT-PCR for Gene Expression
2
Quantifying Human-Chimpanzee Transcriptomic Differences
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primers for qPCR and amplicon sequencing are listed in Supplementary Table 1 . RNA from fibroblasts and iPSCs were reverse transcribed by random hexamers using Superscript III and the resulting first cDNA were used as templates for qPCR. qPCR were performed under standard two-step cycling conditions using TaqMan Universal PCR master mix (Life Technologies) on StepOne Plus platform (Life Technologies). One tenth of the double strand cDNA from the TruSeq procedure for library preparation were saved and used as templates for amplicon sequencing. Since the templates for amplicon sequencing were obtained from the RNA-seq procedures after spike-in of chimpanzee RNA, they represent both human and chimpanzee transcripts. Amplicons were prepared by standard two-step PCR using SYBR Premix ExTaq (Takara). Purified amplicons were subjected to library preparation by TruSeq DNA Sample Preparation Kit (Illumina). Amplicon sequencing was performed on MiSeq (Illumina) platform with a paired-end read length of 250-bp. Human and chimpanzee reads were discriminated based on SNVs in the amplicon and normalized gene expression levels were calculated by dividing the human reads with the chimpanzee reads.
3
Quantitative Analysis of RNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells from overnight (stationary-phase) cultures were inoculated in triplicate into 5 ml LB or M9 and grown at 37°C until exponential phase (OD600 of ∼0.3) or stationary phase. Total RNA was extracted from harvested cells with TRIzol reagent (Life Technologies). RNA was treated with Turbo DNase I for 30 min (Life Technologies) and subjected to quantitative reverse transcriptase PCR (qRT-PCR) as previously described (38 (link)). Briefly, 1 μg total RNA was used for the reverse transcription reaction with Superscript III first strand synthesis system with random hexamers (Life Technologies). Real-time PCR amplification of the synthesized cDNA was conducted using the Fast SYBR green Master Mix kit (Life Technologies). Each of the three biological replicates was analyzed in technical triplicate on the StepOnePlus platform (Life Technologies) using primers shown in Table S3 . The data were analyzed by the ΔΔCT method using rpoC mRNA as an internal control. Log2 fold change was calculated from the ΔΔCT results.
4
SARS-CoV-2 Detection via RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Samples were vortexed, and 50 μL was aliquoted for MagPlate OMEGA extraction following manufacturer protocols. RNA was tested by semiquantitative real time RT-PCR on the StepOnePlus platform (ABI) with qScript XLT 1-Step RT-PCR ToughMix, using five primer sets: one for internal controls (ACTB) and three for SARS-CoV-2 (ORF1b, N1, RdRP). CoVERS-ACTB, Forward: GATGCAGAAGGAGATCAC, Reverse: CTAGAAGCATTTGCGGTG, Probe: HEX-CTCCTGCTTGCTGATCCACA-TAM; HKU-ORF1, Forward: TGGGGYTTTACRGGTAACCT, Reverse: AACRCGCTTAACAAAGCACTC, Probe: FAM-TAGTTGTGATGCWATCATGACTAG-TAM; 2019-nCoV_N1 [CDC], Forward: GACCCCAAAATCAGCGAAT, Reverse: TCTGGTACTGCAGTTGAATCTG, Probe: FAM-ACCCCGCATTACGTTTGGTGGACC-TAM; RdRP_SARSr, Forward: GTGARATGGTCATGTGTGGCmGG, Reverse: CARATGTTAAASACACTATTAGCAmTA, Probe: FAM-CAGGTGGAACCTCATCAGGAGATGC-TAM. All plates were run with negative viral transport medium (VTM) controls and positive control (NR-52285, Genomic RNA from SARS-Related Coronavirus 2, Isolate USA-WA1/2020, BEI Resources).
5
Validating Drought-Tolerance-Related DEGs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To verify the accuracy of RNA-seq sequencing, ten putative drought-tolerance-related DEGs were randomly selected for qRT-PCR verification. The Arah1 gene was used as reference gene. Gene-specific primers were designed using PRIMER5(Table S9 ). QRT-PCRs were performed on an ABI Stepone plus platform. Each gene was analyzed in three biological samples, and three reaction repeats were performed for each biological sample.
6
Quantitative RT-PCR Analysis of Cytokine Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using Trizol reagent (Gibco, Life Technologies, Darmstadt, Germany) according to the manufacturer’s protocol. A reverse transcriptase-polymerase chain reaction was performed after the RNA was amplified by reverse transcription (RT) using an Oligo (dT) primer (Yeasen, Shanghai, China). Specific cDNA products corresponding to the mRNA were amplified and detected by SYBR®Green Real-Time PCR (Yeasen, China). Amplification was performed on the ABI Stepone Plus platform. Primers sequences as follows: TGF-βRIforward: 5′-GTCAGCTGGCCTCGGTC-3′; reverse: 5′-ATGACAGTGCGGTTATGGCA-3′. TGF-β1 forward: 5′-ATACGCCTGAGTGGCTGTCT-3′; reverse: 5′-TGGGACTGATCCCATTGATT-3′. TNF-α forward: 5′-GAGGTCAACCTGCCCAAGTA-3′; reverse: 5′-GGGGGCTCTGAGGATTAGAC-3′. IL-1β forward: 5′-CTGTGACTCGTGGGATGATG-3′; reverse: 5′-GGGATTTTGTCGTTGCTTGT-3′. IL-6 forward: 5′-CCGGAGAGGAGACTTCACAG-3′; reverse: 5′-ACAGTGCATCATCGCTGTTC-3′.MCP-1 forward: 5′-TGATCCCAATGAGTCGGCTG-3′; reverse: 5′-TGGACCCATTCCTTATTGGGG-3′.
7
Quantitative Real-Time PCR Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRI Reagent (Sigma #T9424) or by Renozol (Genoplast #BMGPB1100–2) followed by Total RNA Mini column purification kit (A&A Biotechnology #031–100). 2 μg of RNA was subjected to reverse transcription using M-MLV enzyme (Promega #M1705), dNTP mix 100 mM each (BLIRT #RP65) and oligo (dT)18 primers (Bioline #BIO-38029). The RT-qPCR reaction was performed using SensiFAST SYBR Hi-ROX Kit (Bioline #BIO-92020) on the StepOnePlus™ platform (Thermo Fisher Scientific) according to MIQE guideline. Primers sequences are listed in the Supplementary Information. The comparative 2-ΔΔCt method was used to determine the relative mRNA level using StepOnePlus software. 18SrRNA was used as a reference control. Data are presented as mean values ± SD; n = 3–5. Statistical significance was assessed using unpaired Student’s t-test with Welch’s correction and p ≤ 0,05 was estimated as significant (*p ≤ 0.05; **p ≤ 0.005; ***p ≤ 0.001; ****p ≤ 0.0005).
8
Quantitative RT-PCR of IL-7-Cultured B Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For qRT-PCR on IL-7-cultured B cell precursors, cells were typically harvested on day 7 after transduction, dead/apoptotic cell-depleted, and snap-frozen on dry ice. For thymus and BM, cells were isolated freshly from 53BP1−/− mice and snap-frozen on dry ice. Stimulated B cells were obtained from the spleen and cultured as described previously (Feldhahn et al., 2012 (link)). RNA was isolated as for RNA-seq, and cDNA was generated using the RevertAid cDNA synthesis kit (Thermo Fisher Scientific). qPCR was performed using a SYBR green master mix (Sigma JumpStart) on a StepOnePlus platform (Thermo Fisher Scientific). Information of primers, PCR conditions, and analysis can be found in the Supplemental Experimental Procedures . Analysis of the IGH locus for genomic loss was done as by Jankovic et al. (2013) (link) using the primers and conditions described.
9
MiRNA and piRNA Expression Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
cDNA synthesis was performed using the miRCURY LNA RT Kit (QIAgen), with 0.56 μl of RNA templates added to each reaction according to the equation “Template RNA [µl] = Elution volume [µl]/Original sample volume [µl] * 8 [µl]” (https://www.qiagen.com/us/resources/resourcedetail?id=34039664-5bf4-42b1-9858-f4c28dace788&lang=en ). qPCR was carried out using the miRCURY Probe PCR Kit, run on a StepOnePlus™ platform (Thermo Fisher Scientific) according to the manufacturer’s instructions. miRCURY LNA miRNA Probe Assays were applied in the case of hsa-miR-122-5p, while custom-made miRCURY LNA miRNA Custom Probe Assays were used in the case of hsa_piR_016658 (Table 1
10
Quantifying ABCG2 mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
mRNA was purified from the stable, ABCG2-expressing HeLa cells with PureLink MiniKit (Thermo Fisher Scientific, cat. 12183018A) according to the manufacturer’s instructions. After cDNA conversion (Thermo Fisher Scientific, High capacity cDNA reverse transcription kit, cat. 4368814) mRNA levels were determined with qPCR probes against ABCG2 (Thermo Fisher Scientific, cat. 00184979) and RPLP0 (cat. 99999902), with TaqMan Universal Master Mix (Thermo Fisher Scientific, cat. 4304437) according to the manufacturer’s protocol. Reactions were run on a StepOnePlus™ platform (Thermo Fisher Scientific), and ABCG2 mRNA levels were normalized with ΔΔCt method to RPLP0 mRNA levels.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!