Fast super evagreen qpcr master mix

To confirm the RNA-seq results, we chose ten DEGs from the pathway analysis and quantified them using real-time quantitative PCR (RT-qPCR). In this step, leaf total RNA was extracted with three biological replicates as described above. The gene-specific primers were designed using Primer Premier 5 [68 (link)], and their characteristics are listed in Table S1. PED1, one endogenous control gene, was selected as an internal standard. Two-step amplification with three technical replicates was performed using Fast Super EvaGreen qPCR Master Mix (US Everbright Inc., Suzhou, China) on a Rotor-Gene Q real-time PCR system (Qiagen, Germany). We calculated relative expression levels with the 2^−∆∆Ct method [69 (link)].

The qRT-PCR analysis was performed to validate the DEGs identified by transcriptome sequencing. Total RNA was extracted as described before. An UEIris II RT-PCR System was used for first-strand cDNA Synthesis (with dsDNase) (US Everbright, Suzhou, China). The PCR mixture contained 4 μL of UEIris II RT MasterMix (5X), 1 μL of dsDNase, 14 μL of RNase-free water, and 1 μg of mRNA template. The program was set at 37 °C for 2 min (removing genomic DNA from total RNAs) then 55 °C for 10 min, followed by 85 °C for 10 s. The qRT-PCR assays were performed using a Fast Super EvaGreen® qPCR Master Mix (US Everbright, Suzhou, China) in an ABI 7500 system (Applied Biosystems, USA) with the following program: 95 °C for 2 min; 45 cycles of 95 °C for 10 s, 55 °C for 10 s, 72 °C for 30 s, 95 °C for 15 s, and 60 °C for 60 s. The MrActin was selected as the endogenous reference. All the primers were synthesized by Invitrogen (Beijing, China) (Additional file 8: Table S8). A 20 μL of reaction mix contained 10 μL of 2 × Fast Super EvaGreen® Master Mix, 1 μL of 10 × ROX, 5.5 μL of ddH₂O, 3 μL of cDNA, and 0.5 μg of each primer. The relative expression changes of the endogenous reference and the tested genes were analyzed by the 2^{- △△ CT} method [76 (link)].

Gut bacteria genomes were isolated from equal weight of feces samples of control and acute groups with TIANamp Stool DNA Kit (Tiangen, Beijing, China) as manufactory’s instruction. Six IPA-producing bacteria from literatures were quantified by qRT-PCR by using Fast super EvaGreen qPCR Master Mix (US Everbright Inc., United States) according to manufactory’s instruction. Primers were as follows (5′–3′): for Clostridium sporogenes: F: AAGAACACCAGTGGCGAAGG, R: GTTTACGGCGTGG ACTACCA; for Clostridium botulinum: F: CACATGCA AGTCGAGCGATG, R: AGGCTTTCCCCCACTTTGAG; for Clostridium cadaveris: F: AAATACCCGGGCTCAACCTG, R: CCTCAGTGTCAGTTACAGTCCA; for Peptostreptococcus anaerobius: F: TTTATGAGAGTTTGATCCTGGCT, R: GTGTA TAGGGCAGGTTACCCA; for Peptostreptococcus russellii: F: AA CCGCAAGGAAGAAGTCGT, R: CACCTTCCGATACGGCTA CC; and for Peptostreptococcus stomatis: F: GACTGAGGTGA CAGGTGGTG, R: CCCAACTGAATGCTGGCAAC. PCR products for different bacteria were cloned into vector to generate standard curves separately. Copies of each bacterium per gram of feces in each sample were calculated according to standard curves. Statistical analyses were performed by using GraphPad Prism version 6.01.

To verify the reliability of the Illumina RNA-seq results, 10 DEG-encoding proteins from different TF families were validated by RT-qPCR. A 1-μg RNA sample was reverse transcribed using a HiFiScript cDNA Synthesis Kit (CWBIO, Beijing, China). Gene-specific RT-qPCR primers were designed using Primer Premier 5.0 (Premier, Canada) software (Supplementary Table S5). Tubulin served as an internal reference gene, and RT-qPCR was performed using Fast Super EvaGreen qPCR Master Mix (US Everbright Inc., Jiangsu, China) and an ABI 7500 Real-Time PCR System (Applied Biosystems, Waltham, MA, USA). The PCR volume was 20 μL, which included 10 μL of 2× Fast Super Eva Green Master Mix, 0.5 μL of the forward primer, 0.5 μL of the reverse primer, 0.2 μL of 10× ROX, 2 μL of the cDNA template, and 6.8 μL of denucleated acid water. The reaction conditions were 2 min at 95 °C for denaturation followed by 45 cycles of 5 s at 95 °C, 5 s at 60 °C, and 50 s at 72 °C. The RT-qPCR analysis consisted of three biological and three technical replications.

The methods of RNA extraction and cDNA synthesis were described earlier. The qRT-PCR assays were performed using Fast Super EvaGreen^® qPCR Master Mix (US Everbright, Suzhou, China) in an ABI 7500 system (Applied Biosystems, United States) with the following program: 95^°C for 2 min; 45 cycles of 95^°C for 10 s, 55^°C for 10 s, 72^°C for 30 s, 95^°C for 15 s, and 60^°C for 60 s. The primers used for the amplification of MrERF, MrbZIP, and MrSURNod (Supplementary Table 2) were designed according to the CDS of MrERF (Cluster-20905.1), MrbZIP (Cluster-60183.76174), and MrSURNod (Cluster-60183.75597). All the primers were synthesized by Invitrogen (Beijing, China). A 20 μL reaction mix was set up containing 10 μL of 2 × Fast Super EvaGreen^® Master Mix, 1 μL of 10 × ROX, 5.5 μL of ddH₂O, 3 μL of cDNA, and 0.5 μg of each primer. The relative expression changes of the endogenous reference and tested genes were analyzed by the 2^–ΔΔCT method.

Total RNA extracted and the first‐strand cDNA synthesized were performed as previously described.^[56] qRT‐PCR analysis was performed in 10 µL reactions using the Fast Super EvaGreen qPCR Master Mix (US Everbright Inc., Suzhou, China) with three technical replicates and three biological replicates. The gene‐specific primers were used to analyze the expression. The cotton GhUBQ14 and Arabidopsis AtTUB2 were used for endogenous control in qRT‐PCR.

Eleven (11) AhWRKY genes obtained by Illumina RNA-seq that showed differentially expressed and contained cis-recognition elements involved in the abiotic/biotic stress were randomly selected for validation by quantitative real-time PCR (qRT-PCR). All gene-specific primers were designed by Wcgene Biotech (Shanghai, China) (S1 Table). The housekeeping gene EF1b [52 (link)] was used as an internal control gene for qRT-PCR normalization. The qRT-PCR was run on the LightCycler® 96 instrument using Fast Super EvaGreen® qPCR Master Mix (US Everbright®Inc., China) based on the manufacturer’s instructions. The amplification program was set as follows: 95°C for 2 min followed by 45 cycles of 95°C for 5 s and 60°C for 1 min. Three (3) and two (2) biological and technical repetitions, respectively, were used for each gene sample. All data from qRT-PCR amplification were calculated with 2^−△△CT method [53 (link)]. All expression data were analyzed using the Origin 8.0 software version v6.1052 (B232) (OriginLab Corp, Northhampton, MA, USA).