Tb green premix

Total RNA from 3 days post-fertilization (dpf) and 5dpf isl2a^+/+, isl2a^+/- and isl2a^-/- larvae, was extracted utilizing TRIzol (Ambion, Life Technologies). Reverse transcription of total RNA (1ug) to single-stranded cDNA was carried out using the PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect Real Time, Takara) and further diluted 1:10. Next, we use the Quant Studio 12K Flex Real-Time PCR System (ABI, USA) to perform qRT-PCR. The primer sequences for real-time detection of target gene mRNA are shown in Table S3. The reaction mixture, containing diluted cDNA template, primers, and 2× TB Green Premix (Takara), was amplified under cycling conditions based on the manufacturer’s protocol. Finally, we analyzed the generated data using the corresponding software. The transcripts of all genes were normalized against the housekeeping genes, such as elongation factor 1-alpha (ef1α) and beta-actin (actb). To determine the relative levels of mRNA expression between experimental samples and controls, we used the ΔΔCq method. At the same time, the data comprising the results were from at least two separate experiments run in triplicate.

Total RNA was extracted from the tissues and cells using TRIzol reagent (Takara, Tokyo, Japan) following the manufacturer’s instructions. Quantitative real-time PCR (qRT-PCR) analysis was conducted in reaction volumes of 15 μl containing 1.5 μl of cDNA, 0.3 μl of forward and reverse primers, 6.25 μl of TB Green^TM Premix (Takara), and 6.65 μl of DNase/RNase-Free Deionized Water (Tiangen, Beijing, China). Reaction conditions were based on the manufacturer’s instructions, and the 2^–ΔΔCt method was used to calculate fold changes in gene expression (Livak and Schmittgen, 2001 (link)). The β-actin and U6 genes were used as internal controls, and primer sequences are listed in Supplementary Table 2.

To investigate the effect of ciprofloxacin on the transcriptional levels of biofilm-related genes and global regulators, RT-qPCR analysis was performed using S. aureus Newman. After treatment with or without 0.0625 μg/mL ciprofloxacin at 37°C in TSB for 24 h, bacteria were harvested by centrifugation and washed twice with cold saline. RNA was extracted using a total RNA purification kit (Sangon Biotech). RNA samples were reverse transcribed into cDNA using PrimeScript RT reagent kit (Takara Bio Inc., Dalian, China). qRT-PCR was carried out using TB GreenTM Premix (Takara) on a QuantStudioTM 5 Real-Time PCR System. Gene expression was normalized to gyrB levels and calculated by the ΔΔCt method (Livak and Schmittgen, 2001 (link)). Primers for biofilm-related genes and global regulators are listed in Supplementary Table S1. Each reaction was performed in triplicate.

qRT-PCR analysis was conducted with a reaction volume of 10 μL containing 5 μL TB GreenTM Premix (Takara), 0.5 μL forward and reverse primers, 1 μL cDNA, and 3 μL DNase/RNase-Free Deionized Water (Tiangen, Beijing, China). The reaction conditions followed the protocols and instructions. Chicken GAPDH and U6 were used as the internal controls. According to a gene bank, the primers were designed by Oligo 6.0 software and Primer premier 5.0 software; the primers used are listed in Table 2.
Table 2

Primers used for qRT-PCR

Gene	Sequence (5′ - 3′)	Product Length (bp)	Annealing Temperature (°C)
ATP2B4	F: CCTCCGTCAATTCCACTCCC	89	58
	R: CTACGGAACGCATTCACCAC
GAPDH	F: TCCTCCACCTTTGATGCG	146	59
	R: GTGCCTGGCTCACTCCTT

F Forward primer, R Reverse primer

Total RNAs were isolated from cells using RNAiso Plus (Takara, Dalian, China) following the manufacturer’s protocol. Total RNAs of 0.5 to 1 μg were used as templates for reverse transcription using the PrimeScript^TM RT reagent Kit with gDNA Eraser (Takara, Dalian, China). Quantitative RT-PCR (RT-qPCR) was conducted using TB Green^TM Premix according to the manufacturer’s protocol (Takara, Dalian, China). The RT-qPCR primers GAPDH, U6, RMRP and AKT are as follows, GAPDH: 5′-GGAGCGAGATCCCTCCAAAAT-3′ and 5-′GGCTGTTGTCATACTTCTCATGG-3′, U6: 5′-GCTTCGG CAGCACATATACTAAAAT-3′ and 5′-CGCTTCACGAATTTG CGTGTCAT-3′, RMRP: 5′-TGCTGAAGGCCTGTATCCT-3′ and 5′-TGAGAATGAGCCCCGTGT-3′, and AKT: 5′- AGCGA CGTGGCTATTGTGAAG -3′ and 5′- GCCATCATTCTTGAG GAGGAAGT-3′.

The intestinal tissues stored in the −80 °C were subjected to RNA extraction. Every intestinal segment was opened longitudinally, cleaned by PBS, snap frozen in liquid nitrogen, and grinded into powder with a mortar and pestle. The total RNA from each sample was extracted with an Animal Total RNA Isolation Kit (Sagon Biotech, Shanghai, China) following the manufacturer’s instructions. RNA concentrations were determined by absorbance at 260 nm in a UV spectrophotometer (Thermo Fisher Scientific, Waltham, MA; OD260/280 ≈ 1.9–2.0). After 2 μg RNA was reverse transcribed into 20μL cDNA using a PrimeScrip RT reagent kit (Takara, Tokyo Japan), quantitative real-time PCR was performed by using a CFX96 PCR detection system (BioRad, Hercules, CA, USA) with a SYBR Premix ExTaq (Takara). The conditions of PCR were as follows: 95 °C for 5 min, then 40 cycles of 95 °C, 15 s for denaturation, 60 °C, 60 s for annealing at 70 °C, 25 s for extension. Each qRT-PCR reaction was performed with volumes of 15 µL containing 6.25 µL TB Green TM Premix (Takara), 0.3 µL forward and reverse primers, 1.5 µL cDNA, and 6.65 µL DNase/RNase-Free Deionized Water (Tiangen, Beijing, China). The gene primers used in this experiment are shown in Table 4. The relative expression levels were normalized by internal reference Beta-actin (β-actin) through the 2^−ΔΔCt method.

qRT-PCR analysis was performed in 10 μl reaction volumes containing 1 μl of cDNA, 0.5 μl of forward and reverse primers, 5 μl of TB Green^TM premix (Takara), and 3 μl of DNase/RNase Free deionized water (Tiangen, Beijing, China). The relative expressions of related genes were calculated by the 2^–ΔΔCt method, and three biological replicates were performed on each sample. The proteins were extracted on ice using commercial protein extraction kits (BestBio Biotech Co., Ltd., Shanghai, China) and adjusted to the same concentration, then placed at 95°C to denature for 5 min. The total volume of each well was 20 μl, including 16 μl of protein sample and 4 μl of reducing loading buffer (4:1). The steps and details of the Western blot analysis experiment are described in depth by Liu et al. (2019) (link). The antibodies were diluted according to the manufacturer’s instructions as follows: anti-Bcl2 (Santa Cruz Biotechnology, Santa Cruz, CA, United States), anti-Caspase 3 (Biorbyt, Cambridge, United Kingdom), anti-CDK2 (ABclonal Technology, Wuhan, China), anti-PCNA (ABclonal), and anti-CLF2 (ABclonal, Wuhan, China). The last, anti-β-actin (ZenBio, Chengdu, China; 1:2,000), was used as a loading control.