Dcc genomic DNA that spans exons 16 and 17 (5.6 kb total) was PCR amplified from mouse spinal cords and cloned into the pDEST26 gateway vector containing a CMV promoter (Thermo Fisher). Dcc minigene was transfected into HEK293T cells together with the splicing factors or an empty vector at a 1:1 ratio. Cells were cultured for 48 hr and the total RNA was collected using Trizol (Thermo Fisher). Reverse transcription was carried out from a T7 promoter (present in pDEST26) using SMARTScribe reverse transcriptase (Clontech, Mountain View, CA), and semi-quantitative PCR was performed to amplify multiple isoforms. Point mutations were introduced by PCR reactions using Pfu polymerase (Agilent, Santa Clara, CA), and were confirmed by DNA sequencing. A V5 tag at the C-terminus of NOVA1, NOVA2, and PTBP2 was used to confirm protein expression using western blotting.
Pfu polymerase
Manufactured by Agilent Technologies
Sourced in United States
Pfu polymerase is a thermostable DNA polymerase enzyme derived from the hyperthermophilic archaeon Pyrococcus furiosus. It is capable of high-fidelity DNA synthesis due to its 3' to 5' exonuclease proofreading activity.
Automatically generated - may contain errors
Lab products found in correlation
Pcdna5 frt to vector, by Thermo Fisher Scientific (3 mentions)
Marathon cdna, by Takara Bio (2 mentions)
Quikchange method, by Agilent Technologies (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Cmv promoter, by Thermo Fisher Scientific (1 mentions)
Smartscribe reverse transcriptase, by Takara Bio (1 mentions)
Oligonucleotides, by Eurogentec (1 mentions)
Dna sequencing, by Eurofins (1 mentions)
Pcdna3, by Thermo Fisher Scientific (1 mentions)
Polyethylenimine (pei), by Polysciences (1 mentions)
Primers for pcr, by Integrated DNA Technologies (1 mentions)
Taq polymerase, by New England Biolabs (1 mentions)
Cnbr activated sepharose 4b, by Cytiva (1 mentions)
Glomax multi microplate reader, by Promega (1 mentions)
Dual luciferase reporter assay system, by Promega (1 mentions)
Geneart, by Thermo Fisher Scientific (1 mentions)
T3 polymerase, by Thermo Fisher Scientific (1 mentions)
Corresponding restriction enzymes, by Qiagen (1 mentions)
Gel purification kit, by Qiagen (1 mentions)
T4 ligase, by Promega (1 mentions)
17 protocols using pfu polymerase
1
Dcc Minigene Splicing Assay in HEK293T
2
SREC-II Extracellular Domain Cloning and Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The oligonucleotides used (Eurogentec, Angers, France) are described in Supporting Information .
A synthetic DNA coding for the extracellular moiety of SREC‐II (amino acids 1‐442) was purchased from GeneCust (Dudelange, Luxemburg) (Supporting Information ). A SREC‐II DNA fragment containing an EcoRI restriction site at the 5’‐end and a PacI restriction site at the 3’‐end was generated by PCR using Pfu polymerase (Agilent Technologies, Les Ulis, France), the synthesized DNA fragment, SREC‐II‐EcoRIF and SREC‐II‐PacR oligonucleotides. The pcDNA3.1‐SREC‐II(1‐442) plasmid was obtained by inserting the PCR fragment in the pcDNA3.1‐SR‐F1 plasmid already described [6 (link)] in place of SR‐F1 ectodomain sequence using EcoRI and PacI restriction sites. The recombinant protein ends at amino acid 442 (Gly) of the SREC‐II sequence followed by 3 amino acids (Leu‐Ile‐Lys) and 8 His residues. The sequence was verified by DNA sequencing (Eurofins Genomics, Köln, Germany).
A synthetic DNA coding for the extracellular moiety of SREC‐II (amino acids 1‐442) was purchased from GeneCust (Dudelange, Luxemburg) (
3
Cloning and Mutagenesis of ChR2 Variants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human codon-optimized sequences for ChR2 were cloned into pmCherry-N1, as previously described53 (link). The sequence C1C2-52 with enhanced membrane targeting was cloned via Gibson assembly54 (link) pCDNA3.1 in frame with TS-mScarlet-ER (TS and ER sequence are as described in Grimm et al.55 (link)). Site-directed mutagenesis of ChR2 and C1C2-52 was performed via Quikchange using a Pfu polymerase (Agilent Technologies, Santa Clara, CA).
4
Molecular Cloning of Human MPS1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human MPS1 was amplified from human testis cDNA (Marathon cDNA; Takara Bio) using Pfu polymerase (Agilent Technologies). MPS1 expression constructs were made using pcDNA5/FRT/TO vectors (Invitrogen) modified to encode the EGFP or FLAG reading frames. Mutagenesis was performed using the QuikChange method (Agilent Technologies). DNA primers were obtained from Invitrogen. siRNA duplexes targeting PPP family phosphatase subunits BUBR1 and MPS1 have been described previously (Zeng et al., 2010 (link); Espert et al., 2014 (link); Hayward et al., 2019 (link)). On-target SMARTPools were obtained from Dharmacon Horizon.
5
TNFR1 Plasmid Mutagenesis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TNFR1 plasmid was previously created by cloning into pcDNA3.1A backbone (Hapil et al., 2020 (link)). Site-directed mutagenesis was performed by Pfu polymerase (Agilent Stratagene) reaction using the primers listed in Table 1 . PCR products were digested with DpnI digestion enzyme (NEB) and transformed into competent E.coli. Next day, plasmid miniprep was performed with phenol-chloroform extraction method and plasmid sequences were verified by Sanger sequencing using Applied Biosystems 3130 XL.
6
Transfection of SUCNR1 variants in RGC-5 and HEK 293T cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In vitro experiments were performed in retinal ganglion cells (RGC-5) or human embryonic kidney cells (HEK 293T). RGC-5 cells were a gift from Neeraj Agarwal (University of North Texas Health Science Center, Fort Worth, TX, USA). Typically, 50–60% confluent cells were transfected using the plasmid vector pcDNA 3.1 (Invitrogen, Carlsbad, CA, USA) coding for the different constructions of SUCNR1. Point mutations of SUCNR1 were generated by PCR mutagenesis using Pfu polymerase (Agilent, Santa Clara, CA, USA). All constructs were verified by automated sequencing. For each well, 2 μg of plasmid DNA were incubated with the transfection agent PEI (Polysciences #23966), and were consequently delivered on cells following a 30 min incubation period at RT. Cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) enriched with 10% fetal bovine serum, and incubated at 37 °C in a humidified atmosphere with 5% CO2.
7
Synthesis and Purification of Pantothenic Acid
8
Generating Rat Anti-SDR Antibodies
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To construct an SDR overexpression plasmid, a 730 nucleotide DNA fragment was amplified by PCR using LD44769 (the EST clone of the SDR 5’ region) as template DNA and Pfu polymerase (Agilent/Strategene) and the following two primers: 5’ CGGGATCCGTGGCAGATGTATC3’ and 5’GGAATTCTGCGA TAGTCGTGATTG3’. BamHI and EcoRI digested PCR product was then cloned into the pRSET A vector. The resulting plasmid was used to express and purify 39 kDa recombinant SDR protein, which was used for primary and booster injections into rats to raise rat anti-SDR polyclonal antibodies. Recombinant SDR was coupled to CNBr-activated sepharose 4B (Amersham Biosciences, NJ, USA), and serum taken from rats after the booster injection was applied to this column. Bound antibodies were eluted to recover affinity-purified rat anti-SDR antibodies. Affinity-purified antibody was tested for specificity and cross-reactivity with Drosophila InR protein, as follows. InR and SDR were overexpressed in neuroendocrine cells of fly larvae using the IRP-Gal4 system (IRP-Gal4>UAS-InR or IRP-Gal4>UAS-Sdr). Ectopic expression of SDR was detected in SDR-overexpressing larvae but no immunoreactivity was detected in InR-overexpressing larvae (i.e., IRP-Gal4>UAS-InR) (Fig. 2 ). Therefore, the rat anti-SDR antibody is specific for Drosophila SDR and does not cross-react with InR in Drosophila larvae.
9
Generation of PCTAIRE1 (K194M) Mutant
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Point mutations of PCTAIRE1 (K194M) was made with a PCR-based site-directed mutagenesis method using Pfu polymerase (Agilent). Expression plasmids for various proteins were constructed in the pcDNA3 vector for transfection or pRDI292-puro vector for lentivirus infection. Appropriate plasmid construction was confirmed by restriction enzyme digestion and DNA sequencing. The details of the primer sequences used to generate the point mutations are available upon request.
10
PDL1 Promoter Cloning and Luciferase Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human PDL1 promoter fragment was amplified from the genomic DNA of DLD1 cells using Pfu polymerase (Agilent) and cloned into a pGL3-Basic luciferase reporter vector and confirmed by sequencing. Luciferase reporter assays were performed in DLD1, and LOVO cells using the Dual-Luciferase Reporter Assay System (Promega) according to the manufacturer's instructions. Luciferase activity was measured using the GloMax-Multi Microplate Reader (Promega).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!