Pirfp670 n1

Manufactured by Addgene

Sourced in United States

PiRFP670-N1 is a plasmid that encodes for a far-red fluorescent protein. The plasmid is available for research use.

Automatically generated - may contain errors

Lab products found in correlation

5 protocols using pirfp670 n1

Plasmid Construct Verification

Cited 4 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Restriction enzymes, Klenow polymerase, T4 ligase and Pfu polymerase were purchased from Thermo Fischer Scientific. DNA oligonucleotides were acquired from Microsynth AG [42 ] or Sigma-Aldrich Co. All DNA constructs made were verified by sequencing by Microsynth AG. Plasmids were purified with GenElute HP Plasmid Miniprep kit (Sigma-Aldrich). Q5 polymerase was from New England BioLabs Inc. Dulbecco’s modified Eagle’s Medium, foetal bovine serum, Turbofect, penicillin and streptomycin were acquired from Thermo Fisher Scientific. The following plasmids were acquired from Addgene: piRFP670-N1 #45457 [32 (link)]; pX330-U6-Chimeric_BB-CBh-hSpCas9 #42230 [4 (link)]; pCAG-EGxxFP #50716 [31 (link)]; pY010 (pcDNA3.1-hAsCpf1) #69982 [24 (link)]; pY016 (pcDNA3.1-hLbCpf1) #69988 [24 (link)]; M-ST1cas #48669 [23 (link)]; and pSimpleII-U6-tracr-U6-BsmBI-NLS-NmCas9-HA-NLS(s) #47868, [35 (link)].

Tóth E., Weinhardt N., Bencsura P., Huszár K., Kulcsár P.I., Tálas A., Fodor E, & Welker E. (2016). Cpf1 nucleases demonstrate robust activity to induce DNA modification by exploiting homology directed repair pathways in mammalian cells. Biology Direct, 11, 46.

+ Open protocol

+ Expand

Plasmid Construction and Lentivirus Production

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

GFP-Sec61β plasmids were obtained from Addgene (15108). mCherry-Sec61β plasmids were constructed by replacing GFP with mCherry in the GFP-Sec61β plasmid. Rtn4a-GFP plasmids were obtained from Addgene (61807). Su9-HA-iRFP670 plasmids were generated by cloning the pre-sequence of Su9 (Yamada et al., 2018 (link)) fused to the HA epitope into piRFP670-N1 (Addgene, 45457). GFP-Cyb5 plasmids were made by cloning GFP and rat Cyb5 (100–134 amino acids) into the pcDNA3.1 plasmid.
Lentiviruses were produced as described previously (Kageyama et al., 2014 (link)). The pHR-SIN plasmids carrying full-length, mutant, or truncated Drp1 or N-terminally HA-tagged mouse Climp63 were cotransfected into HEK293T cells with two other plasmids, pHR-CMV8.2ΔR and pCMV-VSVG, using Lipofectamine 2000 (Invitrogen). Two days after transfection, the supernatant of the transfected cells containing released viruses was collected. The viruses were quick-frozen in liquid nitrogen and stored at −80°C. To generate shRNA lentiviruses, the following target sequences were cloned into pLKO.1: Scramble (CCTAAGGTTAAGTCGCCCTCGttcaagagaCGAGGGCGACTTAACCTTAGG) and Drp1 (GCTTCAGATCAGAGAACTTATttcaagagaATAAGTTCTCTGATCTGAAGC). To generate a knockdown-resistant Drp1, the target sequence for Drp1 was changed to GTTGCAAATTCGCGAGCTGAT in pHR-SIN. Lentiviruses were produced as described above.

Adachi Y., Kato T., Yamada T., Murata D., Arai K., Stahelin R.V., Chan D.C., Iijima M, & Sesaki H. (2020). Drp1 Tubulates the ER in a GTPase Independent Manner. Molecular cell, 80(4), 621-632.e6.

+ Open protocol

+ Expand

CRISPR-Cas9 Transfection in HEK293T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

HEK293T cells were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA). Cells were cultured in Dulbecco's modified Eagle's medium (DMEM) + GlutaMAX-I (4.5 g/l D glucose +110 mg/ml sodium pyruvate) supplemented with 10% fetal bovine serum (FBS, Life Technologies, Carlsbad, CA, USA). Cells were cultured at 37°C at 5% CO₂ in a humidified incubator.
Plasmids used for transfections were isolated from PureYield Plasmid Miniprep System (Promega, Madison, WI, USA). The night before transfections, HEK293T cells were seeded at a density of 3 × 10⁵ cells per well in 48 well collagen-treated plates (Corning, NY, USA). Transfection reactions were prepared in 25 μl of Opti-MEM (ThermoFisher Scientific, Waltham, MA, USA). For each transfection, 45 ng of each guide RNA expression vector, 9 ng of reporter plasmid, 9 ng of piRFP670-N1 (Addgene Plasmid 45457) and 160 ng of recCas9 expression vector were mixed, combined with 0.8 μl lipofectamine 2000 in Opti-MEM (ThermoFisher Scientific, Waltham, MA, USA) and added to individual wells.

Chaikind B., Bessen J.L., Thompson D.B., Hu J.H, & Liu D.R. (2016). A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells. Nucleic Acids Research, 44(20), 9758-9770.

+ Open protocol

+ Expand

Optogenetic Control of SWELL1 Channels

Check if the same lab product or an alternative is used in the 5 most similar protocols

SWELL1-iRFP was created by replacing GFP from the SWELL1-GFP plasmid with iRFP. iRFP was amplified using piRFP670-N1 (Addgene, plasmid 45457). SWELL1-iRFP was inserted into lentiviral backbone pLV-EF1a-IRES-Puro (Addgene, plasmid 85132). Forty-eight hours post-shRNA transduction, puromycin (0.5 μg/mL, Gibco) was added to a fresh cell culture medium to select stably transduced cells expressing SWELL1-iRFP.
ARHGEF11(DHPH)-Cry2-mCherry (OptoGEF), CAAX-CIBN-GFP, and mito-CIBN-GFP were gifts from Dr. Xavier Trepat (Institute for Bioengineering of Catalonia). Cry2-mCherry was amplified from ARHGEF11(DHPH)-Cry2-mCherry and inserted into pLV-EF1a-IRES-Hygro (Addgene, plasmid 85134). SWELL1 was amplified from SWELL1-iRFP, and then inserted into pLV-EF1a-IRES-Hygro-Cry2-mCherry to create SWELL1-Cry2-mCherry (OptoSWELL1). Hygromycin B (500 μg/mL, ThermoFisher Scientific) was added to a fresh medium 48 h post-transduction to select cells stably transduced with OptoSWELL1.

Zhang Y., Li Y., Thompson K.N., Stoletov K., Yuan Q., Bera K., Lee S.J., Zhao R., Kiepas A., Wang Y., Mistriotis P., Serra S.A., Lewis J.D., Valverde M.A., Martin S.S., Sun S.X, & Konstantopoulos K. (2022). Polarized NHE1 and SWELL1 regulate migration direction, efficiency and metastasis. Nature Communications, 13, 6128.

+ Open protocol

+ Expand

Lentiviral Vector Construction Toolkit

Check if the same lab product or an alternative is used in the 5 most similar protocols

The CasRx , (pXR001; Addgene #109049), dCasRx (PXR002; Addgene #109050) plasmids, gRNA expression vectors (pXR003, pXR004; Addgene #109053 and #109054), Vesicular Stomatitis Virus glycoprotein (VSV-G) envelope expression vector (pMD2.G; Addgene #12259), lentiviral packaging plasmid (psPax2; Addgene # 12260), iRFP670 fluorescent reporter vector (piRFP670-N1; Addgene#79987) and pKLV2-U6gRNA5(BbsI)-PGKpuro2ABFP-W (Addgene #67974) were obtained from the Addgene repository (Watertown, MA, USA).

Nguyen H., Wilson H., Jayakumar S., Kulkarni V., & Kulkarni S.R. (2021). Efficient inhibition of HIV using CRISPR/Cas13d nuclease system.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!