Gelred nucleic acid stain

Plasmid DNA (1–5 μg) purified from E.coli transformants was digested with EagI (New England BioLabs, Massachusetts, USA). The reaction was incubated at 37 °C in a water bath for 2 h. Screening of DNA fragments after digestion of the recombinant pCR-XL-TOPO EV-A71 plasmid was carried out using DNA agarose gel electrophoresis. The agarose gel was pre-stained with GelRed nucleic acid stain (Biotium, USA) prepared in 0.5X TAE buffer. DNA products were mixed with gel loading buffer and loaded into wells in the agarose gel. Electrophoresis was carried out using 80 V and DNA bands were illuminated with UV light. The size of the DNA fragments were compared with a GeneRuler 1 kbp DNA ladder (Invitrogen, USA).

Viral gene segments were amplified in 50 μl PCR reactions consisting of 2 μl cDNA (representing 10% of the reverse transcription reaction), dNTP mix (0.2 mM each final concentration) (Qiagen), 1 × Pfu buffer, 2.5U Native Pfu DNA polymerase (Stratagene), water and oligonucleotide pairs (final concentration each of 0.2 μM) as listed in Table 1. The cycling conditions were as follows: initial denaturation at 96°C for 1 minute, followed by 25 cycles of denaturation at 96°C for 15 seconds, primer annealing at 50-60°C (see Table 1) for 10 seconds and elongation at 60°C for 5 minutes. PCR reactions were analysed on a 1% agarose gel containing GelRed nucleic acid stain (Biotium) according to manufacturer’s directions. PCR products were purified using a QIAquick PCR purification kit (Qiagen) according to manufacturer’s directions.

Studies were conducted in genetically modified mice. Heterozygote ASIC1a^+/− mating pairs were generously provided by Michael J. Welsh, MD, at the University of Iowa. Genotypic analysis of offspring from heterozygous mating pairs was screened by polymerase chain reaction (PCR). Tail DNA was isolated using direct PCR (Tail, Viagen Biotech, Los Angeles, CA) at 3 weeks of age. PCR reactions were performed with AccuPrime Supermix (Invitrogen, Carlsbad, CA). Oligonucleotide sequences for the wild‐type allele were 5′‐TCTCCTATGAGCGGCTGTCT‐3′ and 5′‐GTCCGTCCCATTCCCTAAGT‐3′. Oligonucleotide sequences for the knockout allele were 5′‐GCCAGAGGCCACTTGTGTAG‐3′ and 5′‐GTCCGTCCCATTCCCTAAGT‐3′. DNA specific to wild‐type and knockout alleles was amplified using a Stratagene Robocycler under the following conditions. Samples were held at 94°C for 2 min, then cycled at 94°C for 30 sec, 55°C for 30 sec, 68°C for 40 sec, for 35 cycles, then held at 68°C for 5 min. PCR products were separated on agarose gels and visualized with GelRed Nucleic Acid Stain (Biotium, Hayward, CA). Wild‐type littermates of ASIC1a knockout mice were used as controls in all experiments. Animals were provided standard rodent chow and water ad libitum. Genotypes were reconfirmed following phenotypic analysis using liver samples. Animals were exposed to 12‐h light (06:00–18:00 h)–dark (18:00–06:00 h) cycles.

Each PCR reaction was performed in a 25-μL reaction volume with 1× HotStar Taq^® Plus Master Mix (QIAGEN GmbH, Hilden, Germany), various concentrations of forward and reverse primers and 50 ng genomic DNA as the template. The tested primer concentrations were 0.16, 0.24, 0.32, 0.40 and 0.8 μM. Two primer pairs (CITS-F10′/CITS- R′-2 and COI-F/COI-R) were simultaneously added into the PCR reaction system to develop a duplex PCR assay for Chinese cordyceps identification. Primer combinations at different concentrations were tested to determine the optimal proportions that influenced the amplification efficiency. A gradient PCR was performed with annealing temperatures ranging from 50 °C to 60 °C in an ABI Veriti 96 thermal cycler (Applied Biosystems). Six temperatures in a gradient, 50 °C, 52 °C, 54 °C, 56 °C, 58 °C and 60 °C, were tested to determine the optimal annealing temperature. The program was as follows: one step of 5 min at 95 °C, 35 cycles of 30 s at 95 °C, 30 s at 50 °C–60 °C and 30 s at 72 °C; followed by one step of 7 min at 72 °C. The PCR products were size separated using electrophoresis on 2.5% agarose gel in 1 × Tris-acetate-EDTA buffer and stained with GelRed Nucleic Acid Stain (Cat. 41003, Biotium, Inc. Fremont, CA, USA) for visualisation. The amplicons were further confirmed by cloning and sequencing (Sangon Biotech (Shanghai) Co. Ltd.).

Size and purity of lysate-catalyzed PCR products were assesed through electrophoretic migration. Electrophoresis of agarose DNA gels was carried out on a wide Mini-sub Cell GT system in TAE buffer with 0.1 × GelRed nucleic acid stain (Biotium, 10,000 × in DMSO) added directly to the gel. For analysis of the 0.9 kb DNA amplicon, 1.2% agarose gels were cast in a 100 × 150 mm format with 40 sample wells and run at 120 V for 20 mins. For the 0.1 kb amplicon, 2.5% agarose gels were cast in the same format and run at 180 V for 15 mins. Analysis samples were prepared by mixing 10 μL of the analyte PCR reaction with 2 μL Gel Loading Dye (Purple 6x, no SDS, New England Biolabs) and gel well-loading of the entire volume. Following electrophoresis, the entire gel was transferred to the Axygen Gel Doc system for imaging of the electrophoresed bands, at 302 nm (2–4 sec exposure) and DNA amplicon migration was compared against suitable molecular weight markers (100 bp or 1.0 kb, both from New England Biolabs) that had been electrophoresed on the same gel.

Nucleic acid of the virus that causes CMD in the coastal region (East African cassava mosaic virus – EACMV) was amplified using the primer pair EAB555F and EAB555R, designed to amplify a 560 bp DNA fragment as described by Ndunguru et al. (2005) . About 20 ng of total nucleic acid was added to the PCR master mix containing One Taq 2x Master mix with standard buffer (M0482S, New England Biolabs) and 200 nM each of the forward and reverse primers. A negative control (no-template) and positive controls (samples obtained from symptomatic plants maintained in the screen house that had previously been tested and shown to have the virus of interest) were also included in the analysis.
PCR amplification was done using a Veriti thermocycler (Applied Biosystems) with the following cycling conditions: initial DNA denaturation at 94°C for 2 min, followed by 30 cycles of denaturation (at 94°C for 30 s), annealing (at 55°C for 30 s) and extension (at 68°C 40 s), then a final extension at 68°C for 10 min. The PCR products were analyzed by gel electrophoresis using 1% (w/v) agarose gels and 1X TAE buffer. The DNA products were stained with GelRed nucleic acid stain (Biotium, California, United States) and the gels were viewed and photographed using the Syngene GBox system (Syngene, Cambridge, United Kingdom). Samples containing DNA bands of about 560 bp were considered as EACMV positive results.

In order to map the induced phages back to the prophage-like elements detected by PHASTER, primers for a multiplex PCR analyses were designed to target specific phage genes. These regions included phage tail, capsid and hypothetical genes (Table S3).
Phage samples were treated with DNAse and RNAse (both at a final concentration of 1 μg mL⁻¹) for 1 h at 37 °C. Inactivation of the enzymes was done at 65 °C for 10 min. The PCR reaction was performed in a 25 μL reaction mixture containing 15.5 μL PCR water, 5 μL PCR 5× red reaction buffer, 0.25 μL BSA 1%, 1 μL Mg⁺² 25 mM, 0.25 μL DNA polymerase (1.25 units), 0.50 μL of each primer (100 pmol) and 1 μL DNA template (~10⁶ phages mL⁻¹). The PCR reaction was run in the thermocycler: 10 min at 96 °C, 30 cycles of 1 min of denaturation at 96 °C, 1 min of annealing at 58 °C, and 1 min of extension at 72 °C, followed by 10 min at 72 °C. PCR products were visualized by agarose 1% gel stained with GelRed Nucleic Acid Stain (Biotium, Fremont, CA, USA). A 100-bp DNA ladder (Omega Bio-Tek, Atlanta, GA, USA) was used as a molecular size marker.