Log In Sign up
The largest database of trusted experimental protocols

Rabbit anti pak1

Manufactured by Cell Signaling Technology
Visit Supplier
Sourced in United States

Rabbit anti-PAK1 is a primary antibody that recognizes the p21-activated kinase 1 (PAK1) protein. PAK1 is a serine/threonine-protein kinase that plays a role in cell signaling pathways involved in cytoskeleton reorganization, cell motility, and cell survival. This antibody can be used to detect and study the expression and localization of PAK1 in various cell and tissue samples.

Automatically generated - may contain errors

Lab products found in correlation

Rabbit anti pak4, by Cell Signaling Technology (3 mentions) Mouse anti gfp, by Roche (3 mentions) Hrp conjugated secondary antibody, by Agilent Technologies (2 mentions) Anti gapdh, by Merck Group (2 mentions) Rabbit anti ha y11, by Santa Cruz Biotechnology (2 mentions) Mouse c myc 9e10, by Santa Cruz Biotechnology (2 mentions) Mouse anti gapdh, by Merck Group (2 mentions) Mouse anti t7, by Merck Group (1 mentions) Mouse anti vinculin, by Merck Group (1 mentions) Mouse anti paxillin, by BD (1 mentions) Staurosporine, by Cell Signaling Technology (1 mentions) Rabbit anti rhou wrch1, by Abcam (1 mentions) Rabbit anti phosphopaxillin s273 272, by Thermo Fisher Scientific (1 mentions) Rabbit anti limk1, by Cell Signaling Technology (1 mentions) Mouse anti actin, by Merck Group (1 mentions) Rabbit anti cofilin, by Cell Signaling Technology (1 mentions) Rabbit anti fmrp, by Abcam (1 mentions) Mouse anti rac1, by Merck Group (1 mentions) Mouse anti sv2, by Developmental Studies Hybridoma Bank (1 mentions) Rabbit anti phospho cofilin, by Cell Signaling Technology (1 mentions)

Spelling variants of this product

Anti-PAK1 (14 citations)

5 protocols using rabbit anti pak1

1

Detailed Antibody Dilutions and Reagent Use

Check if the same lab product or an alternative is used in the 5 most similar protocols
Unless indicated, primary antibodies were used at a dilution of 1:1,000 for Western blotting. Anti-GAPDH was purchased from EMD Millipore and used at a dilution of 1:20,000. Rabbit anti-PAK1, rabbit anti–phospho-PAK4 (S474)/PAK5 (S602)/PAK6 (S560), and rabbit anti-PAK4, which also recognizes PAK6 (Ahmed et al., 2008 (link)), were purchased from Cell Signaling Technology. Rabbit polyclonal PAK4-specific antibody (raised against PAK4 peptide sequence CRRAGPEKRPKSSREG) has been described elsewhere (Wells et al., 2010 (link)). Rabbit anti-RhoU (Wrch1) and rabbit anti-Rab40A were obtained from Abcam and used at a dilution of 1:500. Mouse anti-GFP was obtained from Roche and mouse anti-T7 from EMD Millipore. Rabbit anti-HA (Y-11) and mouse c-Myc (9E10) were purchased from Santa Cruz Biotechnology, Inc. Mouse antipaxillin were obtained from BD, rabbit anti-phosphopaxillin S273(272) from Invitrogen, and mouse antivinculin from Sigma-Aldrich. HRP-conjugated secondary antibodies were purchased from Dako and diluted 1:2,000. Staurosporine was purchased from Cell Signaling Technology and dissolved in DMSO.
Dart A.E., Box G.M., Court W., Gale M.E., Brown J.P., Pinder S.E., Eccles S.A, & Wells C.M. (2015). PAK4 promotes kinase-independent stabilization of RhoU to modulate cell adhesion. The Journal of Cell Biology, 211(4), 863-879.
+ Open protocol
+ Expand
2

Antibody Validation for Western Blotting

Check if the same lab product or an alternative is used in the 5 most similar protocols
Unless indicated, primary antibodies were used at a dilution of 1:1000 for Western blotting. Anti-GAPDH was purchased from Millipore and used at a dilution of 1:20000. Rabbit anti-PAK1, rabbit anti-phospho-PAK4 (Ser 474)/PAK5 (Ser 602)/ PAK6 (Ser 560) and rabbit anti-PAK4, which also recognizes PAK635 (link) were purchased from Cell Signaling Technology. Rabbit polyclonal PAK4 specific antibody (raised against PAK4 peptide sequence CRRAGPEKRPKSSREG) has been described elsewhere37 (link). Mouse anti-GFP was obtained from Roche. Rabbit anti-HA (Y-11) and mouse c-Myc (9E10) were purchased from Santa Cruz. HRP-conjugated secondary antibodies were purchased from DAKO and diluted 1:2000.
King H., Thillai K., Whale A., Arumugam P., Eldaly H., Kocher H.M, & Wells C.M. (2017). PAK4 interacts with p85 alpha: implications for pancreatic cancer cell migration. Scientific Reports, 7, 42575.
+ Open protocol
+ Expand
3

Synaptic Protein Regulation Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
The following antibodies were used in this study: rabbit anti-phospho-cofilin (Ser3; 1:1000; Cell Signaling), rabbit anti-cofilin (1:1000; Cell Signaling Technology), rabbit anti-phospho-LIMK1 (Thr508; 1:1000; Abcam), rabbit anti-LIMK1 (1:1000; Cell Signaling Technology), rabbit anti-phospho-Slingshot1 (Ser978; 1:1000; ECM Biosciences), rabbit anti-Slingshot1 (1:1000; Abcam), rabbit anti–phospho-PAK1 (Ser199; 1:1000; Abcam), rabbit anti–phospho-PAK1 (Thr423; 1:1000; Cell Signaling Technology), rabbit anti-PAK1 (1:1000; Cell Signaling Technology), mouse anti-phospho-PAK4 (Ser474; 1:1000; Santa Cruz Biotechnology), rabbit anti-PAK4 (1:1000; Cell Signaling Technology), mouse anti-Rac1 (1:1000; Millipore), mouse anti-GAPDH (1:50,000; Fitzgerald), mouse anti-actin (1:10,000; Sigma-Aldrich), rabbit anti-FMRP (1:1000; Abcam), rabbit anti-PSD95 (1:1000; Cell Signaling Technology), mouse anti-SV2 (1:2000; Developmental Studies Hybridoma Bank), mouse anti-VAMP2 (1:1000; Thermo Fisher Scientific), rabbit histone H3 (1:1000; Cell Signaling Technology), horseradish peroxidase (HRP)-linked rabbit anti-immunoglobulin G (IgG) (1:5000; Cell Signaling Technology), and HRP-linked mouse anti-IgG (1:5000; Cell Signaling Technology).
Pyronneau A., He Q., Hwang J.Y., Porch M., Contractor A, & Zukin R.S. (2017). Aberrant Rac1-cofilin signaling mediates defects in dendritic spines, synaptic function, and sensory perception in fragile X syndrome. Science signaling, 10(504), eaan0852.
+ Open protocol
+ Expand
4

Western Blot Protein Detection Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Western blots were performed as described previously (McGarry et al., 2016) (link). The following primary antibodies were used in the study; rabbit anti-FLAG (F7425, Sigma), mouse anti-FLAG (F1804, Sigma), mouse anti-myc (M4439, Sigma), rabbit anti-MICAL1 (41112S, Cell Signaling), rabbit anti-phospho-PAK1 T423 (2601S, Cell Signaling), rabbit anti-phospho-PAK1 S144 (2606S, Cell Signaling), rabbit anti-PAK1 (2602S, Cell Signaling), mouse anti-Rab7 (95746S, Cell Signaling), mouse anti-GAPDH (MAB374, Millipore), rabbit anti-phospho-RxxS*/T* (9614S, Cell Signaling), mouse anti-phospho ERK1/2 (9106S, Cell Signaling), rabbit anti-ERK (9102S, Cell Signaling), rabbit anti-GFP (G1544, Sigma), rabbit anti-His-Tag (2365S, Cell Signaling), rabbit anti-GST-Tag (2622S, Cell Signaling). The secondary antibodies used were IRDyeâ 680RD and 800CW (LiCor). Proteins were visualized by infrared imaging using LiCor Odyssey CLx.
McGarry D.J., Castino G., Lilla S., Carnet A., Kelly L., Micovic K., Zanivan S, & Olson M.F. (2022). MICAL1 activation by PAK1 mediates actin filament disassembly. Cell reports, 41(1).
+ Open protocol
+ Expand
5

Targeted Knockdown of PAK5 in RT4 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Control and PAK5 specific siRNA oligonucleotides were transfected into RT4 cells using Lipofectamine RNAiMAX (Invitrogen). The PAK5 targeting sequences and control siRNA were purchased from Qiagen (Qiagen, Skelton House, UK). PAK5 =ATGGTGTGCACGTTTCATTAA or ATGATCTGGATCCGTATTATA; mouse anti-Ecadherin was purchased from Zymed USA, mouse anti-GAPDH was purchased from Sigma, mouse andti-N-cadherin was purchased from Transduction Labs , USA, mouse anti-GFP was purchased from Roche, rabbit anti-PAK1 was purchased from Cell Signalling Technology, USA, rabbit anti-PAK6 from Gentex, USA, rabbit anti-HA and mouse anti-HSP90 were purchased from Santa Cruz Technology USA, In house rabbit anti-PAK4 has been previously described 38 . In house rabbit anti-PAK5 was raised using peptide inoculation (Eurogentec Ltd.) using a synthetic peptide with the following sequence -YREKSLYGDDLDPYY-corresponding to aa146-160 of PAK5 protein -this antibody specifically recognises PAK5 and does not cross react with PAK4 and PAK6 as tested by western analysis using overexpressed proteins (Figure S1A).
Ismail A.F., Oskay Halacli S., Babteen N., De Piano M., Martin T.A., Jiang W.G., Khan M.S., Dasgupta P, & Wells C.M. (2017). PAK5 mediates cell: cell adhesion integrity via interaction with E-cadherin in bladder cancer cells. The Biochemical journal, 474(8).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!