Log In Sign up
The largest database of trusted experimental protocols

Pcdna3.1d v5 his topo vector

Manufactured by Thermo Fisher Scientific
Visit Supplier
Sourced in Belgium, United States

The PcDNA3.1D/V5-His-TOPO vector is a commercially available plasmid vector used for the expression of recombinant proteins in mammalian cell lines. The vector contains a CMV promoter and an SV40 polyadenylation signal for efficient expression, as well as a V5 epitope tag and a 6xHis tag for detection and purification of the expressed protein.

Automatically generated - may contain errors

Lab products found in correlation

E coli top10 cells, by Thermo Fisher Scientific (3 mentions) Geneart site directed mutagenesis system, by Thermo Fisher Scientific (3 mentions) Pcdna3.1 directional topo expression kit, by Thermo Fisher Scientific (3 mentions) Escherichia coli top10f, by Thermo Fisher Scientific (3 mentions) Endofree plasmid giga kit, by Qiagen (3 mentions) P mir 711, by GeneCopoeia (2 mentions) Pcdh cmv mcs ef1 puro, by System Biosciences (2 mentions) Pgbkt7 bait, by Takara Bio (1 mentions) Reverse transcriptase, by Bio-Rad (1 mentions) Pcdna3, by Thermo Fisher Scientific (1 mentions) Pflag cmv 5, by Merck Group (1 mentions) Pcdna3 ha, by Takara Bio (1 mentions) Pegfp n1, by Takara Bio (1 mentions) Endofree plasmid maxi kit, by Qiagen (1 mentions) Fugene 6, by Roche (1 mentions) Pureyield plasmid maxiprep system, by Promega (1 mentions) Q5 site directed mutagenesis kit, by New England Biolabs (1 mentions) Quikchange 2 xl, by Agilent Technologies (1 mentions) Wizard genomic dna purification kit, by Promega (1 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)

21 protocols using pcdna3.1d v5 his topo vector

1

Cloning and Mutagenesis of APOBEC3A Variants

Check if the same lab product or an alternative is used in the 5 most similar protocols
A3A-L strong (A3A-L), A3A-L adequate (A3Aa), A3A-S strong (A3A-S), A3A-S adequate, and catalytic mutants have already been described (16 ). A3A, A3Alt, and derivatives were generated by PCR (Table S1) and cloned into pcDNA3.1D/V5-His-TOPO vector (Thermo Fisher Scientific). A3Alt-L ΔS4, A3Aa ΔS3, A3Aa ΔS4, A3Aa ΔS3ΔS4, and A3Alt-L R48A were generated by site-directed mutagenesis (GeneArt Site-Directed Mutagenesis System, Thermo Fisher Scientific, Table S2). GFP-tagged plasmids were constructed upon amplification of GFP coding sequence using primers designed to add NotI/XbaI restriction site NotI-GFPfwd: TTGCGGCCGCATGGTGAGCAAGGGCGAGGAGC, XbaI-GFPrev: TTTCTAGATTGTACAGCTCGTCCATGCCG, and amplicon was in-frame inserted using NotI/XbaI cloning in pcDNA3.1D/V5-His-TOPO vector C-terminal linker. APOBEC3A-luciferase coding plasmids were constructed by PCR and cloned into pcDNA3.1D/V5-His-TOPO vector (Thermo Fisher Scientific). All constructs were grown in E. coli TOP10 cells (Thermo Fisher Scientific) and verified by sequencing.
Caval V., Suspène R., Khalfi P., Gaillard J., Caignard G., Vitour D., Roingeard P., Vartanian J.P, & Wain-Hobson S. (2021). Frame-shifted APOBEC3A encodes two alternative proapoptotic proteins that target the mitochondrial network. The Journal of Biological Chemistry, 297(3), 101081.
+ Open protocol
+ Expand
2

Yeast Two-Hybrid Screening of HIV-1 Gag

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
The infectious molecular clone pNL-CH [33 (link)], which was derived from the pNL4−3 clone of HIV-1, was a gift from R. Swanstrom. To perform Y2H screening, the Pr55gag and CA coding region of the HIV-1NL–CH were cloned into pGBKT7 (bait) (Clontech Laboratories, Inc.) as previously described [34 (link)].To prepare the ATE1-V5 expression vector, the coding region of ATE1, which was amplified by PCR using the primers ATE1-TCF (5′-AAAGCTTGCCATGGCTTTCTGGGCGGGG-3′) and ATE1-TCR (5′-TCTCGAGCAGTTTCTGAACAGCAGCATCCG-3′), was cloned into the pcDNA™ 3.1D/V5-His-TOPO® vector (Thermo Fisher Scientific, Inc.).
Kishimoto N., Okano R., Akita A., Miura S., Irie A., Takamune N, & Misumi S. (2021). Arginyl-tRNA-protein transferase 1 contributes to governing optimal stability of the human immunodeficiency virus type 1 core. Retrovirology, 18, 30.
+ Open protocol
+ Expand
3

Cloning and Sequencing of USP18 cDNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
The RAW264.7 cells were cultured as detailed above. Total RNA was extracted from human macrophages and cDNA was synthetized by using reverse transcriptase (Biorad). USP18 cDNA was synthetized and amplified by PCR with the following primers: USP18 cDNA Forward: 5’-CACCATGAGCAAGGCGTTTGGG-3’ and USP18 cDNA Reverse: 5’-GCACTCCATCTTCATGTAAACCA-3’. The USP18 cDNA was purified and inserted into pcDNA3.1D/V5-His TOPO vector (Thermo Fisher Scientific). The cDNA was confirmed by DNA sequencing.
Pinilla-Vera M., Xiong Z., Zhao Y., Zhao J., Donahoe M.P., Barge S., Horne W.T., Kolls J.K., McVerry B.J., Birukova A., Tighe R.M., Foster W.M., Hollingsworth J., Ray A., Mallampalli R., Ray P, & Lee J.S. (2016). Full Spectrum of LPS Activation in Alveolar Macrophages of Healthy Volunteers by Whole Transcriptomic Profiling. PLoS ONE, 11(7), e0159329.
+ Open protocol
+ Expand
4

Mammalian APOBEC1 cDNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Mammalian APOBEC1 cDNAs, from armadillo, cat, cow, dog, hedgehog, human, macaque, marmoset, mouse, opossum, pig and rabbit were synthesized (GeneCust), amplified by PCR and cloned into pcDNA3.1D/V5-His-TOPO vector (Life Technologies) (Additional file 1: Table S1). Mouse A1 C93S inactive catalytic mutant was obtained by site directed mutagenesis using standard protocol (GeneArt Site-Directed Mutagenesis System, Life Technologies) (Additional file 1: Table S2). Human APOBEC3A and APOBEC3A C106S, mouse APOBEC2 and mouse APOBEC3 plasmids were previously described [15 (link), 37 (link)]. Dual promoter vector encoding uracil-DNA glycosylase inhibitor UGI from Bacillus subtilis phage, was generated using BamHI/NheI restriction sites to substitute PGK driven GFP sequence from pSF-CMV-PGK-daGFP vector (Sigma) by UGI sequence cloned into pcDNA3.1 vector. APOBEC1 coding sequences were cut from pcDNA3.1D/V5-His-TOPO vectors using HindIII and PmeI and cloned into pSF-CMV-PGK-UGI using HindIII and EcoRV restriction sites. All constructs were grown in E. coli TOP10 cells (Life Technologies) and verified by sequencing.
Caval V., Jiao W., Berry N., Khalfi P., Pitré E., Thiers V., Vartanian J.P., Wain-Hobson S, & Suspène R. (2019). Mouse APOBEC1 cytidine deaminase can induce somatic mutations in chromosomal DNA. BMC Genomics, 20, 858.
+ Open protocol
+ Expand
5

Cloning and Sequencing of TCF 21 Gene

Check if the same lab product or an alternative is used in the 5 most similar protocols
The TCF 21 gene (NM_198392; 3249 bp; CDS 278-817) was amplified by PCR using specific forward: CCACGACTCTGGGAGTG (18-35), and specific reverse: GGAATCCTGCGTGCCAT (3122-3139) primers. The purified PCR product (3121 bp) was inserted into pcDNA™3.1D/V5-His-TOPO vector according to the manufacturer’s protocol (Life Technologies) and transformed into competent cells. The presence of the insert was confirmed by Hind III and XhoI double restriction enzyme digestion. The fidelity of cloned sequence was confirmed by DNA sequencing.
Wei J., Zhang L., Li J., Zhu S., Tai M., Mason C.W., Chapman J.A., Reynolds E.A., Weiner C.P, & Zhou H.H. (2017). MicroRNA-205 promotes cell invasion by repressing TCF21 in human ovarian cancer. Journal of Ovarian Research, 10, 33.
+ Open protocol
+ Expand
6

APOBEC3 Expression Plasmid Construction

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
APOBEC3A, APOBEC3Ap2 and APOBEC3B expression plasmids and catalytic mutants have been previously described (6 (link),9 (link),25 (link)) and were used to generate chimeras by PCR (Supplementary Table S1) or site directed mutagenesis (GeneArt® Site-Directed Mutagenesis System, Life Technologies) (Supplementary Table S2). To overcome toxicity in E. coli, A3BnA and rhesus APOBEC3B (RhA3B) plasmids were synthetized retaining intron 7, and subsequently cloned into pcDNA3.1D/V5-His-TOPO vector (Life Technologies). Rhesus-A3A expression plasmid was previously described and used to generate the rhesus-A3Ap2 plasmid using PCR. All constructs were grown in E. coli TOP10 cells (Life Technologies) and verified by sequencing.
Caval V., Bouzidi M.S., Suspène R., Laude H., Dumargne M.C., Bashamboo A., Krey T., Vartanian J.P, & Wain-Hobson S. (2015). Molecular basis of the attenuated phenotype of human APOBEC3B DNA mutator enzyme. Nucleic Acids Research, 43(19), 9340-9349.
+ Open protocol
+ Expand
7

ORF57 Expression Vector Construction

Check if the same lab product or an alternative is used in the 5 most similar protocols
All ORF57 expression vectors were generated by cloning of ORF57 genomic or cDNA fragments into various eukaryotic expression vectors. The vector pVM1 expressing C-terminally V5-His-tagged ORF57 was generated by TOPO cloning of genomic region of ORF57 into pcDNA3.1D/V5-His-TOPO vector (Invitrogen). The pcDNA3.0 (Invitrogen) containing ORF57 cDNA was used for the expression of untagged ORF57, pFLAG-CMV-5.1 (Sigma) for the expression of C-terminal FLAG-tagged ORF57 (pVM7), pFLAG-myc-CMV-22 for the expression of both N-terminal FLAG- and C-terminal myc-tagged ORF57 (pVM78), pcDNA3-HA for the expression of C-terminal HA-tagged ORF57 (pVM79), and pEGFP-N1 (Clontech) for the expression of ORF57-GFP fusion protein.
Majerciak V, & Zheng Z.M. (2015). Alternative RNA splicing of KSHV ORF57 produces two different RNA isoforms. Virology, 488, 81-87.
+ Open protocol
+ Expand
8

COLQ Minigene Constructs for Spliceosomal Studies

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
We constructed E15E16 (wt and p.E415G) minigenes spanning COLQ exon 15 to 16 and E16E17 (wt and p.E415G) minigenes spanning COLQ exon 16 to 17 in pcDNA3.1D/V5-His-TOPO vector (Invitrogen). Amplicons were generated by PCR using pCI-COLQ (wt or p.E415G), and cloned into pcDNA3.1D/V5-His-TOPO vector.
We introduced three copies MS2-coat protein binding hairpin sequences at the 3′ end of E16E17 (wt and E415G) constructs using the megaprimer method45 (link). At first, we PCR-amplified a fragment harboring three copies MS2-coat protein binding hairpin sequences from pSP64-MS2 vector35 (link) with the primers carrying complementary sequences to E16E17 minigene where the MS2-sequences is being inserted. The PCR amplicon was used as a megaprimer for the QuikChange site-directed mutagenesis system. These vectors were used as templates to generate MS2-attached RNA substrates of E16E17 (wt and p.E415G) for isolation of early spliceosomal complex. As control, we used MS2-attached human β-globin exon 1-intron 1-exon 2 construct (pSP64-HβΔ6-MS2) as previously described35 (link).
Rahman M.A., Azuma Y., Nasrin F., Takeda J.I., Nazim M., Ahsan K.B., Masuda A., Engel A.G, & Ohno K. (2015). SRSF1 and hnRNP H antagonistically regulate splicing of COLQ exon 16 in a congenital myasthenic syndrome. Scientific Reports, 5, 13208.
+ Open protocol
+ Expand
9

Engineered ACVR1 Receptor Plasmid Generation

Check if the same lab product or an alternative is used in the 5 most similar protocols
A human wild-type (WT) ACVR1 expression plasmid was generated by cloning the protein-coding sequence of human ACVR1 into pcDNA 3.1 D V5-His-TOPO vector (Invitrogen) and the ACVR1 R206H plasmid generated by site-directed mutagenesis of the WT ACVR1 [15 (link)]. This same approach was used with the indicated oligonucleotides (with mutant nucleotide underlined) for ACVR1 constitutively active (CA) (forward 5′: GTACAAAGAACAGTGGCTCGCGATATTACACTG-3′, reverse 5′: GCGAGCCACTGTTCTTTGTACCAGAAAAGGAAG-3′); ACVR1 G328E (forward 5′: GATATTTGGGACCCAAGAGAAACCAGCCATTGC-3′; reverse 5′: CTTGGGTCCCAAATATCTCTATGTGCAAATGTGC-3′); ACVR1 G328W (forward 5′: GATATTTGGGACCCAATGGAAACCAGCCATTGC-3′; reverse TTGGGTCCCAAATATCTCTATGTGCAAATGTGCT-3′); ACVR1 G356D (forward 5′: TTGCATAGCAGATTTGGACCTGGCAGTCATGC-3′; reverse 5′:CCAAATCTGCTATGCAACACTGTCCATTCTTCT-3′). The pSmad1/5/8-responsive BRE luciferase reporter (BRE-Luc; [17 (link)]) was used in the luciferase reporter gene assay with the pRL-TK renilla luciferase (Renilla-Luc) expression construct (Promega) as a control.
To generate ACVR1 ligand-binding domain deletion (ΔLBD) expression plasmids, amino acids 35–99, encoding the ligand-binding domain of the ACVR1 receptor, were deleted from full-length expression plasmids by site-directed mutagenesis PCR; an HA-tag was inserted at the N-terminal end of the protein [14 (link)].
Haupt J., Xu M, & Shore E.M. (2017). Variable signaling activity by FOP ACVR1 mutations. Bone, 109, 232-240.
+ Open protocol
+ Expand
10

Allelic Variant Profiling of MEF2D

Check if the same lab product or an alternative is used in the 5 most similar protocols
The MEF2D minigene constructs containing different allelic variants of rs200395694 were prepared as follows: one intact 2.9 kb region (positions: chr1:156,479,713–156,482,610; hg38) containing four exons including two alternative exons α1 and α2 [17 ] together with introns was amplified by PCR from a DNA sample with known heterozygous genotype and cloned into pcDNA3.1 D/V5-His -TOPO vector (Invitrogen). The resulting plasmids were validated by Sanger sequencing and purified with EndoFree Plasmid Maxi kit (Qiagen) for transfection experiments. The minigenes were tested in Jurkat, THP-1, HEK293, and C2C12 cell lines using quantitative reverse transcription (RT-PCR) for transcript detection (Supplementary Methods).
Farias F.H., Dahlqvist J., Kozyrev S.V., Leonard D., Wilbe M., Abramov S.N., Alexsson A., Pielberg G.R., Hansson-Hamlin H., Andersson G., Tandre K., Bengtsson A.A., Sjöwall C., Svenungsson E., Gunnarsson I., Rantapää-Dahlqvist S., Syvänen A.C., Sandling J.K., Eloranta M.L., Rönnblom L, & Lindblad-Toh K. (2018). A rare regulatory variant in the MEF2D gene affects gene regulation and splicing and is associated with a SLE sub-phenotype in Swedish cohorts. European Journal of Human Genetics, 27(3), 432-441.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!