The PCR primers ATPfor and ATPrev (Espanhol et al. 2007 (link)) were used to amplify 838 bp of the mitochondrial gene ATPase subunits 6 and 8. This locus was chosen to facilitate comparison with previous data from Espanhol et al. (2007 (link)) and Mateus et al. (2011 ). Each 20 μL reaction contained 1.2 μL (final conc. 1.5 mm ) MgCl2, 2 μL dNTPs (2.0 mm ), 0.2 μL of each primer (10 mm ), 4 μL of Colorless GoTaq® Reaction Buffer (Promega), 0.1 μL GoTaq DNA polymerase (Promega) and 1 μL of template DNA. Cycle conditions were as follows: initial denaturation at 94 °C for 3 min, followed by 30 cycles of; denaturation at 94 °C for 1 min, annealing temperature 57.1 °C for 1 min and extension at 72 °C for 2 min; and followed by a final extension at 72 °C for 2 min. The resulting PCR products were purified using the Qiagen PCR Purification kit and sequenced using an ABI PRISM 3730 DNA Analyser (DBS genomics Durham University).
Colorless gotaq reaction buffer
Manufactured by Promega
Sourced in United States
Colorless GoTaq Reaction Buffer is a buffer solution designed for use with the GoTaq DNA polymerase enzyme in polymerase chain reaction (PCR) applications. The buffer provides the necessary ionic conditions and pH for optimal enzyme activity and DNA amplification.
Automatically generated - may contain errors
Lab products found in correlation
Gotaq dna polymerase, by Promega (8 mentions)
Gotaq g2 dna polymerase, by Promega (3 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (2 mentions)
Superscript 2, by Thermo Fisher Scientific (2 mentions)
Rnaseout recombinant ribonuclease inhibitor, by Thermo Fisher Scientific (2 mentions)
Lightcycler 480 instrument, by Roche (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Turbo dnase, by Thermo Fisher Scientific (2 mentions)
Phase lock gel tubes, by Avantor (2 mentions)
Sybr green with gotaq dna polymerase, by Promega (2 mentions)
Gotaq hot start dna polymerase, by Promega (2 mentions)
Green gotaq reaction buffer, by Promega (2 mentions)
Pcr purification kit, by Qiagen (1 mentions)
Gotaq polymerase, by Promega (1 mentions)
M mlv reverse transcriptase rnase h minus, by Promega (1 mentions)
Qiaquick pcr purification kit, by Qiagen (1 mentions)
Nuclease free water, by Thermo Fisher Scientific (1 mentions)
Pcr nucleotide mix, by Promega (1 mentions)
Dntps, by Thermo Fisher Scientific (1 mentions)
Exosap it pcr product cleanup reagent, by Thermo Fisher Scientific (1 mentions)
17 protocols using colorless gotaq reaction buffer
1
Mitochondrial ATPase Subunits Amplification
2
Primer Design and PCR Validation for E. atami
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primers were designed using a coverage-masked version of the E. atami genome. using Primer3(Koressaar and Remm, 2007 (link)) (version 4.1.0). PCR validation reactions amplification were performed using GoTaq® DNA polymerase (Promega, 1.2 units/50 μl reaction), Colorless GoTaq® Reaction Buffer, 1 μg of genomic DNA template and 100 ng of oligonucleotide primer. PCR cycling conditions included a 3 minute initial denaturation step at 95 °C, 34 cycles of a three-step thermal cycling consisting of a 30 second denaturation at 95 °C, a 30 second primer annealing step at 55–65 °C (Table S12 ), and a 30 second extension step at 72 °C. A final extension at 72 °C was performed on all reactions to ensure production of full length amplicons. Amplification was assessed by agarose gel electrophoresis. Eight primer pairs with ambiguous signal in the first rounds of PCR were redesigned and retested (Table S12 ). We note that some PCR markers may not be fully diagnostic with respect to germline specificity, since, as observed in zebra finch, somatic gene duplicates have been continuously captured by the germline restricted chromosome since its presumptive origin within the ancestral songbird lineage(Kinsella et al., 2019 (link))).
3
cDNA Generation and qPCR Quantification
4
cDNA Synthesis and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To generate cDNA, total RNA was isolated from frozen cell samples using TRIzol reagent (Thermo Fisher Scientific) and Phase Lock Gel tubes (VWR), treated with Turbo DNase (Thermo Fisher Scientific), and reverse-transcribed using SuperScript II or SuperScript III Reverse Transcriptase (Thermo Fisher Scientific) with oligo(dT) primers in the presence or absence of RNaseOUT Recombinant Ribonuclease Inhibitor (Thermo Fisher Scientific). Quantitative PCR (qPCR) reactions by adding 20 μL master mix containing 1.1X Colorless GoTaq Reaction Buffer (Promega), 0.7 mM MgCl2, dNTPs (0.2 mM each), primers (0.75 μM each), and 0.1X SYBR Green with GoTaq DNA polymerase (Promega) to 2 μL cDNA, mock-RT samples, or water in 22 μL reactions. Reactions were run on a LightCycler 480 Instrument (Roche). Experiments were performed in technical triplicates. RT-qPCR primers used were against ACTB (oBA74: GCTACGAGCTGCCTGACG, oBA75: GGCTGGAAGAGTGCCTCA), KIF2C (oMYC032: CAACTCCAAAATTCCTGCTCC, oMYC033: GAACTGAAAACTGCTTGCGG), TACC3 (oMYC038: ACAGACGCACAGGATTCTAAG, oMYC039: GTTTTGGCATCCACTTCCTTG).
5
Quantifying AOS Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated with DNA-free RNA isolation protocols (56 (link)). Total RNA (400 ng) was used to synthesize complementary DNA with the M-MLV Reverse Transcriptase, RNase H minus (Promega, Dübendorf, Switzerland), first-strand synthesis system. Quantitative polymerase chain reaction (PCR) analysis was performed on 10 ng of cDNA with a homemade master mix containing GoTaq polymerase (Promega) and 5× colorless GoTaq reaction buffer (Promega), 0.2 mM deoxynucleotide triphosphates, 2.5 mM MgCl2, 30 nM 6-carboxy-X-rhodamine dye, and SYBR Green in a final volume of 20 μl. Ubiquitin-conjugating enzyme (UBC21) At5g25760 (57 (link)) was used as reference gene. AOS (At5g42650) transcripts (58 (link)) were displayed relative to UBC21.
6
Triplex Primer PCR for Polymorphic Loci
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A long ssDNA polynucleotide triplex PCR mixture was prepared with 1X Colorless GoTaq® reaction buffer (containing 1.5mM MgCl2) (Promega), 200uM of each dNTP (Promega, USA), 1U GoTaq® Hot Start DNA Polymerase (Promega), 500nM of each of the following primers (IDT): PEM1325FW, PE26RVFL, D5S200FW, D5S60RVTM and 250nM of CSF200FW and CSF60RVJOE.
7
Mitochondrial DNA D-loop Amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Amplification was carried out by using primers designed to amplify an 825 bp fragment length from the D-loop of mitochondrial DNA (mtDNA) between positions 103 and 927 (accession number U92243), based on the published Bos taurus mitochondrial D-loop DNA reference sequence [40 ]. The two flanking primers used were as follows: forward: 5’-CAGAATTTGCACCCTAACCAA-3’ and reverse: 5’-GGGGCCTGCGTTTATATATTG-3’ . Polymerase chain reaction (PCR) was performed in a 10 μl reaction mixture containing 60–80 ng of genomic DNA, 0.1 mM dNTP, 2 mM MgCl2, 0.7 U of GoTaq DNA Polymerase, 5X Colorless GoTaq Reaction Buffer (Promega, USA) and 10 pmol of each primer. PCR conditions were as follows: 10 min at 95°C, 35 cycles of 30s at 95°C, 45 s at 60°C, 30s at 72°C and a final step at 72°C for 10 min. Sequencing reactions were performed by Macrogen Inc. (The Netherlands)
8
Genomic DNA Extraction and PCR from Worms
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Worms (L1 to adults) were digested with proteinase K (1 mg/ml, final) (Roche Diagnostics, 03 115 828 001) in 1× Colorless GoTaq Reaction Buffer (Promega, M792A), first by snap-freezing for 15 min and then by incubating for 1 hour at 65°C to obtain a worm lysate. The proteinase K was inactivated 15 min at 95°C.
PCR was performed using GoTaq polymerase (GoTaq G2 DNA Polymerase, Promega, M748B) with 1.5 μl of worm lysate from proteinase K–treated worms, 5 μl of 5× Green GoTaq Reaction Buffer (Promega, M791A), 2 μl of primers at 10 μM, 0.25 μl of deoxynucleoside triphosphate at 20 mM, 0.125 μl of GoTaq polymerase, and 14.1 μl of water.
PCR was performed using GoTaq polymerase (GoTaq G2 DNA Polymerase, Promega, M748B) with 1.5 μl of worm lysate from proteinase K–treated worms, 5 μl of 5× Green GoTaq Reaction Buffer (Promega, M791A), 2 μl of primers at 10 μM, 0.25 μl of deoxynucleoside triphosphate at 20 mM, 0.125 μl of GoTaq polymerase, and 14.1 μl of water.
9
Alu-gag PCR for Integrated HIV DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Integrated HIV DNA was amplified with the Alu-gag PCR based on a previously published method [20 (link)]. 1 μg of extracted DNA was used as template in each PCR containing 1× Colorless GoTaq Reaction buffer (Promega), 100 nM Alu Forward primer: 5′GCCTCCCAAAGTGCTGGGATTACA-3′ and 600 nM gag Reverse primer: 5′GTTCCTGCTATGTCACTTCC-3′ [20 (link)] PCR nucleotide mix (Promega) [200 µM], Go Taq G2 DNA polymerase (M7841 Promega) 2.5 U, in a final reaction volume of 50 µl. Samples were heated to 95 °C for 2 min. The DNA was amplified during the 40 PCR cycles as follows: 95 °C, 15 s; 50 °C, 15 s; 72 °C, 5 min.
The Alu-gag PCR products were purified with the QIAquick PCR purification kit (Qiagen) according to the manufacturer’s instructions. The purified PCR products were eluted in 30 µl nuclease free water (Ambion).
The Alu-gag PCR products were purified with the QIAquick PCR purification kit (Qiagen) according to the manufacturer’s instructions. The purified PCR products were eluted in 30 µl nuclease free water (Ambion).
10
Targeted PCR and Sanger Sequencing of CNVs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primers targeting sequences upstream and downstream the breakpoints of Chr6 and Chr9 deletions CNVs were designed for PCR and Sanger Sequencing (Supplementary Table ). PCR was performed in a 30 µL reaction volume containing 1X Colorless GoTaq Reaction Buffer (Promega, #M792B), 200 µM dNTPs (Invitrogen, #18427013), 0.5 µM forward and 0.5 µM reverse primers, GoTaq DNA Polymerase (Promega, #M3008) and 1µL of template gDNA. To prepare PCR products for Sanger Sequencing we enzymatically purified the products using ExoSAP-IT PCR Product Cleanup Reagent (Applied Biosystems, #78201.1.ML). Purified PCR products were mixed with the forward primer at 1.67 µM and Sanger sequenced in Genewiz.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!