Recombinant human syndecan 2

Murine macrophages were seeded at 2 × 10⁶ cells/60‐mm dish in Roswell Park Memorial Institute (RPMI) 1640 medium with 10% FBS, and after 2 h, the attached cells were M0 macrophages. Interferon (IFN)‐γ 10 ng·mL⁻¹ and E. coli LPS 10 ng·mL⁻¹ were added to each dish to induce M1 macrophage polarization. CM or EV equivalents from 5 × 10⁵ hMSCs, PBS, or recombinant human syndecan‐2 (R&D System, Minneapolis, MN, USA—500 ng·mL⁻¹ [24 (link)]) were added to each dish. The cells were cultured for 48 h, and RNA was then extracted from the macrophages, and the expression of arginase‐1 and nitric oxide synthase (NOS)2 was assessed by qRT‐PCR. The primers used for mouse arginase‐1 were forward 5′‐ATGGAAGAGACCTTCAGCTAC‐3′ and reverse 5′‐GCTGTCTTCCCAAGAGTTGGG‐3′. The primers used for mouse NOS2 were forward 5′‐GCCACCAACAATGGCAACA‐3′ and reverse 5′‐CGTACCGGATGAGCTGTGAATT‐3′.