RNA was separated from collected cells using TRIzol. RNA concentration was measured using NanoDrop 2000 Spectrophotometer (Thermo Scientific, Wilmington, DE, USA). Reverse Transcription Kit (Takara, Tokyo, Japan) was used for reverse transcription of extracted RNA. QRT-PCR was then performed with SYBR Premix Ex Taq TM (Vazyme, China) on Light Cycler 480 (Roche, Switzerland). The expression levels of mRNA were quantified by the comparative cycle threshold (CT). The CT values of mRNA and miRNA were then used to analyze the fold changes of RNA by the 2−ΔΔCt methods (mRNA and miRNA were normalized by GAPDH and U6, respectively). All the PCR primers were listed in Table 1 .
Sybr premix ex taq
Manufactured by Vazyme
Sourced in China, United States
SYBR Premix Ex Taq is a ready-to-use PCR mix containing SYBR Green I dye, Taq DNA polymerase, and necessary reaction components. It is designed for real-time PCR applications.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (19 mentions)
Primescript rt reagent kit, by Takara Bio (9 mentions)
Primescript rt reagent kit, by Vazyme (8 mentions)
Trizol, by Thermo Fisher Scientific (5 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (4 mentions)
Trizol reagent, by Vazyme (4 mentions)
Rneasy mini kit, by Qiagen (3 mentions)
Trizol reagent, by Takara Bio (3 mentions)
7500 real time pcr system, by Vazyme (3 mentions)
Hiscript 3 rt supermix for qpcr, by Vazyme (3 mentions)
Reverse transcription kit, by Takara Bio (2 mentions)
Nanodrop 2000c, by Thermo Fisher Scientific (2 mentions)
Dnase 1, by Beyotime (2 mentions)
Nuclease free water, by Vazyme (2 mentions)
Rnaiso plus, by Takara Bio (2 mentions)
Purelink rna mini kit, by Thermo Fisher Scientific (2 mentions)
7500 fast qpcr system, by Thermo Fisher Scientific (2 mentions)
Reverse transcription kit, by Vazyme (2 mentions)
Primescript first strand cdna synthesis kit, by Takara Bio (2 mentions)
Genejet rna purification kit, by Thermo Fisher Scientific (2 mentions)
61 protocols using sybr premix ex taq
1
Quantification of mRNA and miRNA Expression
2
Quantitative Gene Expression Analysis of Follicular Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from follicles using a Trizol reagent (Vazyme, Nanjing, China). RNA concentrations were measured using a NanoDrop 2000c (Thermo Scientific, Waltham, USA). The cDNA was generated from 2 μg total RNA using a HiScript II 1st Strand cDNA Synthesis Kit (Vazyme, Nanjing, China) according to the manufacturer's protocol. qPCR was performed in triplicate using a SYBR Premix Ex TaqTM (Vazyme, Nanjing) in ABI 7500 HT Real-Time PCR machine (Applied Biosystems, Foster City, CA, USA). The qPCR conditions were as follows: 95°C for 10 min and then 40 cycles of 95°C for 30 s, 64°C for 34 s, and 72°C for 30 s. The 2−ΔΔCt formula method was used to analyze relative mRNA expression calibrated with β-actin as the reference gene. Primers were listed in Table 2 .
Sequences of the primers for PCR.
| Gene name | Accession no. | Primer sequence (5′-3′) | Product size (bp) |
|---|---|---|---|
| CCND1 | NM_205,381.1 | F: CCTCAAGAAAAGCCGGTTGC | 86 |
| R: CTGCGGTCAGAGGAATCGTT | |||
| CDK2 | NM_0,011,99857.1 | F: TCCGTATCTTCCGCACGTTG | 183 |
| R: GCTTGTTGGGATCGTAGTGC | |||
| Caspase-3 | NM_204,725.1 | F: CAGCTGAAGGCTCCTGGTTT | 98 |
| R: GCCACTCTGCGATTTACACG | |||
| VEGFA | NM_0,011,10355.1 | F: GTCGTACATATTCAGGCCATC | 197 |
| R: GATTCTTTGGTCTGCAGTCAC | |||
| NOS3 | JQ434761.1 | F: GAACCCCCAAGACCTACGTGC | 180 |
| R: CCTGCCCCATGGTCATTCCTC | |||
| β-actin | NM_205,518 | F: ACACCCACACCCCTGTGATGAA | 136 |
| R: TGCTGCTGACACCTTCACCATTC |
3
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNeasy Mini Kit (74104, Qiagen) was employed to extract total RNA. Complementary DNA was then prepared using the PrimeScript RT reagent Kit (RRO47A, Takara Bio Inc) through reverse transcription. The SYBR Premix Ex Taq TM (q711–03, Vazyme Biotech Co., Ltd) was utilized for qRT-PCR. Table 1 lists primers utilized in qRT-PCR. All data were normalized to β-actin.
4
RT-qPCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using Total RNA Isolation Kit (FOREGENE, Chengdu, China), and first strand cDNA was synthesized using HiScript II Reverse Transcriptase (Vazyme, Nanjing, China) according to the manufacturer’s instructions. cDNAs were amplified with gene-specific primers which were designed using Primer Premier 5 software. All the primers used in this experiment were listed in Supplementary Table S3
5
Quantitative Real-Time PCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The extracted RNA was reverse transcribed into cDNA using the Prime Script RT reagent kit (Takara, Dalian, China) according to the manufacture's guidelines. The qRT-PCR reaction solution was prepared in a total volume of 12.5 µL containing 1 µL cDNA, 6.25 mL of 2× SYBR Premix Ex Taq (Vazyme Biotech, Nanjing, China), 4.25 µL of ddH2O, and 0.5 µL of each specific primer pair (10 µM). The reactions were conducted under the following conditions: pre-denaturation at 95 • C for 10 s, followed by 40 cycles of denaturation at 95 • C for 5 s and annealing/extension at the corresponding temperature of each primer pair for 30 s. An 80-cycle melting curve was performed, with the temperature ranging from 60 • C to 95 • C and increasing by 0.5 • C every 10 s. Each sample were amplified in triplicate, and the relative mRNA expression levels of target genes were normalized to the reference genes GAPDH and β-Actin using the comparative Cq method (∆∆Cq) [48] (link). The primer pairs used for qRT-PCR are listed in Table 1.
6
Extracting and Analyzing RNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol reagent (Invitrogen, United States, catalog No. 15596-026). Reverse transcription from whole RNA to complementary DNA (cDNA) and amplification of the cDNA were performed using a Prime Script-RT reagent kit (Vazyme Biotech, China, catalog No. R123-01) and SYBR Premix Ex Taq (Vazyme Biotech, China, catalog No. Q111-02) according to the manufacturer’s instructions. The expression of target genes of NPMSCs in different groups was calculated by the comparative Ct method. The primers were designed according to the sequences in GenBank using Prime 5.0 software and are listed in Table 1 .
7
Quantitative Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cells, sEVs, and tissue using TRIzol reagent (Invitrogen). Then cDNA was synthesized from at least 1 μg of RNA using the HiScript II SuperMix (Vazyme Biotech Co., Ltd., China). Quantitative polymerase chain reaction (qPCR) was carried out with a QuantStudio 6 Flex Real-Time PCR System (Life Technologies, Carlsbad, CA) using SYBR Premix ExTaq (Vazyme Biotech Co., Ltd., China) and gene-specific primers (Table S1 ). The data were analyzed using the 2−ΔΔCT method, with Actin as internal control.
8
Quantitative PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cellular RNA was isolated from cultured cells using Trizol reagent (Invitrogen) and reverse transcribed into cDNA using the M‐MLV assay kit (Invitrogen) according to the manufacturer's instructions. These cDNA samples were subjected to qPCR amplification of different genes with their primer sequences (Table S1 ) in 10 µL of the qPCR mixture in a Bio‐Rad PCR amplifier (Hercules, CA). The qPCR mixture included 5 μL SYBR Premix Ex Taq (Vazyme, Nanjing, China), 0.5 μL of each primer (10 pmol/μL), 1 μL cDNA template and 3 μL ddH2O. Amplification conditions were initially set at 95°C for 5 minutes and then 40 cycles of 95°C for 5 seconds and 65°C for 30 seconds. The results were analysed using the Applied Biosystems QuantStudio 7 Flex software using 2−(Ct‐Cc) (Ct and Cc were the mean threshold cycle differences after normalizing to β‐actin).
9
Quantifying mRNA Expression via RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using Trizol (Vazyme, Nanjing, China), and first-strand cDNA was synthesized with Superscript III Reverse Transcriptase (Beyotime, Shanghai, China) using 0.5 mg of RNA as the template for each reaction. mRNA levels were quantified under optimized conditions using SYBR Premix Ex Taq (Vazyme, Nanjing, China) according to the manufacturer's instructions. The reference gene used was β-actin.
10
Muscle Gene Expression Analysis Pipeline
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Muscle RNA extraction, reverse transcription, and qPCR were performed following the procedures established for our laboratory [35 (link)]. RNA was extracted using RNAiso Plus (Takara Bio, Kusatsu, Japan), treated with DNase I (Beyotime), and analyzed for purity and quantity via agarose gel electrophoresis and spectrophotometry (A260/280 ratio), respectively. Reverse transcription was performed using the PrimeScript™ RT Reagent Kit (Takara Bio). The reaction system for qPCR contained 1 µL complementary DNA, 0.2 µL ROX, 5 µL SYBR Premix Ex Taq, 0.4 µL primers, and 3.4 µL nuclease-free water (Vazyme, Nanjing, China). The reaction was run in a QuanStudio 5Real-Time System (Life Technologies, Carlsbad, CA, USA) according to manufacturer protocol. The oligonucleotide primers used are presented in Table S4 . The 2−ΔΔCT method was used to calculate the changes in target gene expression relative to β-actin levels.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!