Crizotinib

ERL, tivantinib, dasatinib, osimertinib, olmutinib, crizotinib, and cabozantinib were purchased from MedChemExpress LLC (Princeton, NJ, USA). CDODA-Me was kindly donated by Dr. Stephen Safe (Texas A & M University, College Station, TX, USA). RPMI 1640 medium, fetal bovine serum (FBS), crystal violet, hank balanced salt solution (HBSS), and penicillin-streptomycin-neomycin were purchased from Sigma Aldrich (St. Louis, MO, USA). Primary antibodies were purchased from Cell Signaling Technologies (Danvers, MA, USA), and β-actin was purchased from Santa Cruz Biotechnology, Inc. (Carlsbad, CA, USA). The non-small cell lung cancer cell line, HCC827, was purchased from American Type Culture Collection (ATCC) (Manassas, VA, USA); the HCC827R cell line (ERL-resistant) was provided by Dr. Arun Rishi (Wayne State University, Detroit, MI, USA).

Lentiviral vector pLKO.1 containing short hairpin RNA (shRNA) sequence targeting GOLM1 (GAACAGTGTGAGGAGCGAATA) or scramble sequence (TCGAAGGAATAGTGAGGAACG) was constructed for GOLM1 knockdown. The GOLM1 full-length coding sequence was cloned from Hanjiahuai cDNA library into a lentivirus vector. Karpas 299 cells were subjected to CRISPR/Cas9-mediated knockout of GOLM1 by lentiviral infection of lentiCRISPR v2 based vector carrying the guide sequences specific for GOLM1 (shown in supplemental Figure 7B). Positive single-cell clones were screened using 4 μg/mL puromycin and verified by sequencing and western blot. The ALK inhibitors CEP28122 (kindly provided by Mariusz A. Wasik) and crizotinib (MedChemExpress) were used for the inhibition of ALK activity.

Human neuroblastoma cell lines, both MYCN non-amplified (SH-SY5Y, SK-N-AS, CHLA-255) and MYCN-amplified (NGP, LAN5, CHLA-255-MYCN), were routinely cultured and maintained as described previously [40] (link). CHLA-255 and CHLA-255-MYCN cell lines were courtesy provided by Dr. Leonid Metelitsa of Baylor College of Medicine, Houston [41] (link). Control fibroblast cell lines WI-38, NIH-3T3, and COS-7 were obtained from ATCC. Briefly, all NB cell lines were cultured in RPMI-1640, NIH-3T3 and COS-7 cell lines were cultured in DMEM, and WI-38 cell line was cultured in EMEM media, supplemented with 10% FBS, 1% penicillin/streptomycin, and 1% l-glutamine. All cell lines were validated via short-tandem repeat analysis for genotyping within the past 6 months and routinely tested for Mycoplasma monthly. Primary antibodies anti-PDK1(3062S), anti-pPDK1 (Ser241; 3438S), anti-AKT (9272S), anti-pAKT (Thr308; 9275S), anti-p70 S6 kinase (S6K; 9202S), anti-p-p70 S6 kinase (pS6K; Thr389; 9205S), anti-cyclophilin B (43603S), and anti-rabbit IgG HRP-linked secondary antibody (7074S) were purchased from Cell Signaling Technology. BX-795, crizotinib, and doxorubicin were purchased from MedChemExpress, NJ.

Cell viability was determined using cell counting kit-8 (CCK-8) assay (ab228554, Abcam, Burlingame, CA, USA). 3000 cells per well were seeded in a 96-well plate, and treated with 10 uM Gefitinib (ZD1839, MedChemExpress, NJ, USA), or 10 uM Crizotinib (PF-02341066, MedChemExpress, NJ, USA). At 0 h, 24 h, and 48 h, the CCK8 regent was added and incubated for 60 min at 37 °C, the absorbance (OD value) was detected at a wavelength of 450 nm.