RNA was extracted with the RNeasy system (QIAGEN, Valencia, CA), and cDNA was synthesized with the SuperScript VILO cDNA synthesis kit (Invitrogen). Quantitect SYBR Green qPCR kit (QIAGEN) and the Applied Bioscience 7500 Real Time PCR system were used for quantitative PCR. Primers for gapdh, ugcg and b4galt6 were all obtained from QIAGEN.
Quantitect sybr green qpcr kit
Manufactured by Qiagen
Sourced in United States, Germany, Canada
The Quantitect SYBR Green qPCR kit is a reagent kit designed for real-time quantitative PCR (qPCR) analysis. The kit contains the necessary components, including a SYBR Green-based detection system, for performing quantitative gene expression analysis.
Automatically generated - may contain errors
Lab products found in correlation
Quantitect reverse transcription kit, by Qiagen (2 mentions)
Oligo dt, by Promega (2 mentions)
Rotor gene 3000 instrument, by Qiagen (2 mentions)
Rotorgene amplification software v6, by Qiagen (2 mentions)
Superscript 2, by Thermo Fisher Scientific (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Rneasy system, by Qiagen (1 mentions)
Superscript vilo cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
Ribozol, by Avantor (1 mentions)
Cfx96 real time system, by Bio-Rad (1 mentions)
Iq5 real time pcr system, by Bio-Rad (1 mentions)
Viia 7 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
M mlv reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Rotor gene q, by Qiagen (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Pgl3 ctrl, by Promega (1 mentions)
Icycler, by Bio-Rad (1 mentions)
Rotor gene 6000, by Qiagen (1 mentions)
11 protocols using quantitect sybr green qpcr kit
1
Quantitative PCR for Gene Expression
2
Quantifying TGF-β4 Expression in Chicken PBMCs and Spleen
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The PBMCs (1 × 106) (n = 6/group) were collected from the experimental birds as mentioned above at 24 and 48 h post-booster and one mL of RiboZol™ (Amresco, USA) was added. Similarly, one mL of RiboZol™ was added to spleen tissue collected following sacrifice (n = 3/group). Total RNA extraction was done by phenol : chloroform and isopropanol method and the purity was checked by absorbance at 260 and 280 nm in a Nanodrop UV spectrophotometer. Total RNA was used for the preparation of cDNA employing Revertaid™ First Strand cDNA Synthesis Kit (Thermo Scientific, USA), following manufacturer's instructions.
Quantification of the TGF-β4 gene was done by QuantiTect SYBR Green qPCR kit (Qiagen, CA, USA) on CFX96 Real Time System (Bio-Rad, CA, USA) following the published report [28 (link)]. β-actin served as the housekeeping gene. Published primer sequences were used for β-actin (F: 5′ TATGTGCAAGGCCGGTTT 3′, R: 5′ TGTCTTTCTGGCCCATACCAA 3′) [29 (link)] and TGF-β4 (F: 5′ CGGCCGACGATGAGTGGCTC 3′, R: 5′ CGGGGCCCATCTCACAGGGA 3′) [30 (link)] genes. Each sample was tested in triplicate on the same plate. Expression of TGF-β4 was calculated relative to the β-actin gene and expressed as n-fold increase or decrease relative to the control. The data of real time PCR was calculated by 2−ΔΔCt method [31 ].
Quantification of the TGF-β4 gene was done by QuantiTect SYBR Green qPCR kit (Qiagen, CA, USA) on CFX96 Real Time System (Bio-Rad, CA, USA) following the published report [28 (link)]. β-actin served as the housekeeping gene. Published primer sequences were used for β-actin (F: 5′ TATGTGCAAGGCCGGTTT 3′, R: 5′ TGTCTTTCTGGCCCATACCAA 3′) [29 (link)] and TGF-β4 (F: 5′ CGGCCGACGATGAGTGGCTC 3′, R: 5′ CGGGGCCCATCTCACAGGGA 3′) [30 (link)] genes. Each sample was tested in triplicate on the same plate. Expression of TGF-β4 was calculated relative to the β-actin gene and expressed as n-fold increase or decrease relative to the control. The data of real time PCR was calculated by 2−ΔΔCt method [31 ].
3
Quantifying Ammonia-Oxidizing Microbes by qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Ammonia monooxygenase subunit A (amoA) genes of archaeal, betaproteobacterial, and comammox Nitrospira were quantified by quantitative PCR (qPCR) using primers for archaeal amoA,41 (link) bacterial amoA,42 (link) and comammox amoA clade A and B20 (link) using the QuantiTect SYBR® Green qPCR kit (Qiagen, Germantown, MD) in a Bio-Rad IQ5 real-time PCR system (Bio-Rad, Hercules, CA). Genomic DNA of Nitrososphaera viennensis strain EN76 and Nitrosospira briensis Nsp10 was used as qPCR standards for archaeal and betaproteobacterial amoA, respectively. A comammox amoA standard was made from a comammox amoA clone plasmid carrying the most abundant sequence type found in our samples (OTU11). Further details of qPCR conditions and data analysis were provided in the Supplementary Materials and Methods . PCR amplification efficiencies were 86% for archaeal amoA, 90% for bacterial amoA and 96% for comammox amoA.
4
Comparative Stem Cell Marker Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
As stem cell marker expression is crucial in cancer cell lines a distinct marker panel covering the canine genes CD44, CD133, c-KIT, CD34, ITGA6, MYC, NANOG, DDX5, KLF4, SOX2, MELK and OCT4 (assay details see previous reports [19 (link), 23 (link)]) was analyzed comparatively by relative quantitative real-time PCR (qPCR) to evaluate stable transfection induced expression changes among CT1258 and fluorescent cell lines CT1258-FusionRed, CT1258-mKate2C and CT1258-TurboFP650.
Total RNA was extracted from CT1258 and fluorescent cells using RNeasy mini Kit (Qiagen, Hilden, Germany). cDNA synthesis was carried out using 500 ng of total RNA in 20 µl according to the manufacturer’s protocol for the QuantiTect Reverse Transcription Kit (Qiagen, Hilden, Germany). The qPCR reactions were performed using the ViiA™ 7 Real-Time PCR System (Life Technologies) and QuantiTect SYBR green qPCR Kit (Qiagen). ß-actin (ACTB) and Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH) were used as endogenous control. The qPCR results were analyzed using the delta delta CT (ΔΔCT) method relative to CT1258 cells. For each cell line, three samples of different passages were used. All samples were analyzed in triplicates including non-template and non-reverse transcriptase controls for each reaction.
Total RNA was extracted from CT1258 and fluorescent cells using RNeasy mini Kit (Qiagen, Hilden, Germany). cDNA synthesis was carried out using 500 ng of total RNA in 20 µl according to the manufacturer’s protocol for the QuantiTect Reverse Transcription Kit (Qiagen, Hilden, Germany). The qPCR reactions were performed using the ViiA™ 7 Real-Time PCR System (Life Technologies) and QuantiTect SYBR green qPCR Kit (Qiagen). ß-actin (ACTB) and Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH) were used as endogenous control. The qPCR results were analyzed using the delta delta CT (ΔΔCT) method relative to CT1258 cells. For each cell line, three samples of different passages were used. All samples were analyzed in triplicates including non-template and non-reverse transcriptase controls for each reaction.
5
Quantitative Gene Expression Analysis of Fungal Elicitor-Treated Calli
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from fungal elicitor treated calli and non-treated calli by the RNeasy Plant Mini Kit for qRT-PCR (Qiagen, Hilden, Germany), and converted to cDNA using M-MLV reverse transcriptase (Invitrogen, Carlsbad, CA, USA). qPCR analysis was performed using Rotor-Gene Q (Qiagen, Hilden, Germany) with a QuantiTect SYBR Green qPCR Kit (Qiagen, Hilden, Germany). The relative expression value of the genes was calculated using the 2−ΔΔCT method [37 (link)]. The β-actin gene of P. koraiensis was used for normalization. qPCR analysis was performed with three replicates. The data are presented as the average relative quantities ± SEs. The primers for qPCR analysis used in this study are listed in Table S1 .
6
Quantitative PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Gene expression was measured by quantitative PCR as reported [58 (link),59 (link)]. Briefly, RNA was extracted from BMDCs using the Trizol reagent (Invitrogen, Burlington, ON, Canada) and reverse transcribed using Superscript II (Invitrogen) and OligodT (Promega, Madison, WI, USA). Real-time PCR reactions were performed in a volume of 25 µL containing 10 ng of cDNA and 1 µM of each forward and reverse primers, using a Quantitect SYBR Green qPCR kit (Qiagen, Montreal, QC, Canada) in a Rotorgene 3000 instrument (Corbett Research, Sydney, Australia). Primer sequences used are listed in Table 1 . Amplification plots were generated using Rotorgene Amplification software v6.0 (Corbett Research), and relative gene expression changes were calculated using the 2−ΔΔCt method and normalized using β-actin expression.
7
Quantitative RT-PCR Analysis of Cytokines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from 5 × 106 BMDCs using Trizol (Invitrogen, Burlington, ON, Canada) and 1 µg of the resulting RNA was reverse transcribed using Superscript II (Invitrogen, Burlington, ON, Canada) and OligodT (Promega, Madison, WI, USA). Duplicate real-time PCR reactions for each sample were performed in a volume of 25 µL containing 10 ng of cDNA and 1 µm of each forward and reverse primers (Supplementary Table S1 ), using a Quantitect SYBR Green qPCR kit (Qiagen, Montreal, Quebec, Canada) in a Rotorgene 3000 instrument (Corbett Research, Sydney, Australia). Reaction conditions were as follows: 95 °C for 5 min, followed by 35 cycles (94 °C for 30 s, 60 °C for 45 s, 72 °C for 60 s in the case of IL-12p35 and IL-12p40 or 94 °C for 30 s, 64 °C for 45 s, 72 °C for 60 s in the case of IL-10 and TGF-β. Amplification plots were generated using the Rotorgene Amplification software v6.0 (Corbett Research) and fold increases were calculated using the 2−ΔΔCt method and normalized using β-actin expression.
8
Monitoring DNA Translocation through Lipid Bilayer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After formation of the lipid bilayer, TBCP was added in the cis chamber at a concentration of 10 µg.mL -1 and ionic current measurements were then recorded for a voltage of -100 mV. Once the first interactions between TBCP and the lipid membrane were observed, the pGL3-ctrl (Promega Madison, WI, USA; 5256 base pairs) plasmid DNA (pDNA) was added in the trans chamber at a concentration of about 160 µg.mL -1 . The ionic current was then applied again with a voltage of -100 mV. After 35 min, the solutions in cis and trans chambers were carefully collected to avoid any disruption of the membrane. The quantity of pDNA in each chamber was finally determined by using the QuantiTect SYBR Green qPCR kit (Qiagen, Chatsworth, CA, USA) in accordance with the manufacturers' recommendations, as previously reported. [57]
9
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with TriZOL (Invitrogen, Carlsbad, CA, USA), quantified, and stored at −80 °C until analysis. Total RNA (1 µg) was reverse transcribed using the Quantitect reverse transcription kit (Qiagen, San Diego, CA, USA). PCR reactions were performed in duplicate with Quantitect SYBR green qPCR kit (Qiagen, San Diego, CA, USA) using approximately 50 ng of total cDNA equivalent per reaction. PCR was run with denaturation at 95 °C for 15 s, annealing at 51–55 °C for 20 s, and extension at 72 °C for 10 s/100 bp. The BioRad iCycler equipped with a real-time optical fluorescent detection system was used for SYBR Green detection. β-Actin was found to be a more stable housekeeping gene than 18S and RPL19 [55 (link)]. Primers were designed using the NCBI primer design tool and tested for efficiency; only primers with efficiency between 90 and 110% were selected. The primer sequences, together with their accession numbers, are shown in Table 3 . Negative controls (no template) and positive controls (reference sample) were included. To obtain relative fold mRNA levels we used the delta/delta Ct method and DMSO-treated CO-ShUVECs as the control group.
10
Quantitative Real-Time PCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
cDNA was synthesized with oligo-dT priming using the SuperScript III First Strand Synthesis Kit (Invitrogen). The equivalent of 10 ng of starting RNA was used as template in a 15 μl reaction using the Quantitect SYBRgreen qPCR Kit (Qiagen). Reactions were performed in a RotorGene 6000 (Corbett Research) and results analyzed using RotorGene 6000 Software (version 1.7). Samples were normalized to pmp-3 expression prior to comparison between groups (Hoogewijs et al., 2008 (link)). See Table S8 for primer sequences. Relative expression was calculated as described (Nolan et al., 2006 (link)).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!