Total RNA was extracted with Trizol reagent (Invitrogen) followed by phenol-chloroform extraction protocol. cDNA synthesis (Superscript II RNase H reverse transcriptase, Invitrogen) was prepared from 2 μg of RNA and amplified with REDExtract-N-Amp PCR Reaction Mix (Sigma) using the specific primers described in Supplementary Table 2 . Amplified fragments were separated on TAE-agarose gel and stained with SYBR safe (Invitrogen).
Redextract n amp pcr reaction mix
Manufactured by Merck Group
Sourced in United States
REDExtract-N-Amp PCR Reaction Mix is a pre-mixed solution containing all the necessary components for performing polymerase chain reaction (PCR) amplification. It includes a thermostable DNA polymerase, reaction buffer, dNTPs, and a red dye for tracking the reaction progress.
Automatically generated - may contain errors
Lab products found in correlation
Redextract n amp tissue pcr kit, by Merck Group (2 mentions)
Sybr safe, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Superscript 2 rnase h reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Sybr safe dna gel stain, by Thermo Fisher Scientific (1 mentions)
Chemidoc imaging system, by Bio-Rad (1 mentions)
Extraction solution, by Merck Group (1 mentions)
Neutralization solution b, by Merck Group (1 mentions)
Tissue preparation solution, by Merck Group (1 mentions)
Rneasy micro kit, by Qiagen (1 mentions)
Dnase 1, by Thermo Fisher Scientific (1 mentions)
Abi prism 7000, by Thermo Fisher Scientific (1 mentions)
Mycycler, by Bio-Rad (1 mentions)
Power sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions)
Bigdye terminator v3, by Thermo Fisher Scientific (1 mentions)
Pcr system 9700, by Thermo Fisher Scientific (1 mentions)
Multiscreen filter plate, by Merck Group (1 mentions)
Abi 3730 genetic analyser, by Thermo Fisher Scientific (1 mentions)
Myfi dna polymerase, by Meridian Bioscience (1 mentions)
7 protocols using redextract n amp pcr reaction mix
1
Total RNA Extraction and cDNA Amplification
2
Genotyping protocol for Wdr62 gene-trap mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Wdr62 genetrap Mus musculus (mice) on C57Bl/6 background were housed in the UQBR animal house facility. All animal experiments and breedings were approved by the Animal Ethics Committee at the University of Queensland. Both male and female adult heterozygous mice were used for timed matings. Mating was assumed at midnight and timed from 0.5 day. Embryos and newborns from both sexes were collected at E14.5, E16.5 and P0 for brain cortical analysis. Male mice at P5, P21, P28 and adult (>6 weeks old) were used for testis experiments, while female mice at 8 weeks old were used for ovary analysis. The genotype of each mouse or embryo was confirmed by PCR. DNA was extracted from the toe clips of mice or embryonic tails using the REDExtract-N-Amp Tissue PCR kit (Sigma) according to the manufacturer’s instruction. The PCR reaction comprised of 1× REDExtract-N-Amp PCR reaction mix (Sigma), 0.4 μM Forward oligo P1 (5′ GTTGTGTCTGCTCTGTGTGG 3′), 0.4 μM Reverse oligo P2 (5′ CTGTGATGCCAAGCACC 3′), 0.4 μM Reverse oligo P3 (5′ CAACGGGTTCTTCTGTTAGTCC 3′), 2 μL DNA template and water to a final volume of 20 μL. The PCR cycling condition involved 35 cycles of 30 s denaturation at 94 °C, 30 s annealing at 60 °C and 45 s extension at 72 °C. The expected PCR size for wild type is one band at 485 bp, heterozygous two bands at 485 and 276 bp, and homozygous is one band at 276 bp.
3
Knockout Clones Generation by CRISPR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
J77 cells were transfected with a combination of two plasmids with sgRNA directed towards two different targets (1 + 6 or 6 + 8). One GFP + cell was sorted to each well (96-well plate), containing pre-conditioned media. This media was obtained from a J77 cell culture after centrifuging at high speed, and filtering the supernatant with a 0.22 µm strainer. For genotyping forward (CCTCTTTTCATCCATAAGCCAC) and reverse (TAGACCTCTCTCCATCCACCTC) were designed to amplify by PCR a region (856nt) including all targets (1, 6 and 8). Knock out clones were identified for removal of fragments 1–6 (274nt) or 6–8 (302nt), leading to an amplification of a smaller region (582 and 554, respectively). Genomic DNA was isolated with Gentra Puregene cell kit (Qiagen, 158745-K). PCR was performed with REDExtract-N-Amp PCR Reaction mix (Sigma-Aldrich, R4775), and resolved in 3% agarose (Agarose D1 Low EEO, Covalab) gels stained with ethidium bromide (Sigma-Aldrich, E-1510).
4
Genotyping of Fmr1 Knockout Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The tails from eight randomly selected pups from a pool of pups at ages P7, P14 or P21 (4 pups from each genotype, WT and Fmr1 KO) were collected and the genotypes of the mice were confirmed for each group via PCR (data not shown). Segments of tails 0.5–1 cm in length were each combined with 100 μl of Extraction Solution (catalog#: E7526; Sigma-Aldrich) and 25 μl of Tissue Preparation Solution (catalog#: T3073; Sigma-Aldrich). Samples were incubated for 10 min at 55°C and then for 3 min at 95°C. Following these incubations, 100 μl of Neutralization Solution B (catalog#: N3910; Sigma-Aldrich) was added to each sample. To perform PCR, REDExtract-N-Amp PCR Reaction Mix (catalog#: R4775; Sigma-Aldrich) was added to each sample along with the following primers (with final primer concentrations of approximately 1 μM): CAC GAG ACT AGT GAG ACG TG (mutant forward; primer oIMR2060; Jackson Laboratory, Bar Harbor, ME, USA), TGT GAT AGA ATA TGC AGC ATG TGA (WT forward; primer oIMR6734; Jackson Laboratory), CTT CTG GCA CCT CCA GCT T (common; primer oIMR6735; Jackson Laboratory). Following PCR, the amplified DNA samples were run through a 2% agarose gel. Gels were imaged using SYBR Safe DNA Gel Stain (Invitrogen) and a ChemiDoc Imaging System (Bio-Rad).
5
Root Hair RNA Isolation and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Root hairs cells were harvested as described in Breakspear et al.38 (link). RNA isolation from collected root hairs was performed with the RNeasy micro kit (Qiagen), according to the manufacturers protocol. Residual DNA was removed with DNAse I (Thermo). First strand cDNA synthesis was carried out using the High Retrotranscriptase Kit (Biotools) with 1 µg of DNA-free root hair RNA.
End-point RT-PCR reaction was performed in MyCycler (BioRad) on 30-fold diluted cDNA using the REDExtract-N-Amp PCR Reaction Mix (Sigma). The same cDNA was used for qPCR using the Power SYBR Green PCR Master Mix (Applied Biosystems, Life Technologies), following the manufacturer’s recommendations in ABI PRISM 7000 (Applied Biosystems, Life Technologies). Amplification of a rip1 (Medtr5g074860) gene 160 bp fragment was carried out using primers RIP1F: 5′-GATGCAAGAACAGCAAGCAA-3′ and RIP1R: 5′-AGTGTGGCCACCAGAAAGAG-3′. All results were standardized to the Histone-3-like (Medtr4g097170) expression levels (primers EF1αF; 5′-CTTTGCTTGGTGCTGTTTAGATGG-3′ and EF1αR; 5′-ATTCCAAAGGCGGCTGCATA-3′) as previously described39 (link). The 2-∆∆Ct method40 (link) was applied to determine relative gene expression.
End-point RT-PCR reaction was performed in MyCycler (BioRad) on 30-fold diluted cDNA using the REDExtract-N-Amp PCR Reaction Mix (Sigma). The same cDNA was used for qPCR using the Power SYBR Green PCR Master Mix (Applied Biosystems, Life Technologies), following the manufacturer’s recommendations in ABI PRISM 7000 (Applied Biosystems, Life Technologies). Amplification of a rip1 (Medtr5g074860) gene 160 bp fragment was carried out using primers RIP1F: 5′-GATGCAAGAACAGCAAGCAA-3′ and RIP1R: 5′-AGTGTGGCCACCAGAAAGAG-3′. All results were standardized to the Histone-3-like (Medtr4g097170) expression levels (primers EF1αF; 5′-CTTTGCTTGGTGCTGTTTAGATGG-3′ and EF1αR; 5′-ATTCCAAAGGCGGCTGCATA-3′) as previously described39 (link). The 2-∆∆Ct method40 (link) was applied to determine relative gene expression.
6
Mitochondrial COI Gene Amplification Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted from muscle or branchial tissue with REDExtract-N-AmpTissue PCR Kit (Sigma-Aldrich, St. Louis, MO, USA). A fragment of the mitochondrial Cytochrome Oxidase I (COI) gene was amplified using the universal primers LCO1490 and HCO2198 (Folmer et al., 1994 (link)). Amplifications were performed in a final volume of 20 μL using 10 μL of REDExtract-N-amp PCR reaction mix (Sigma-Aldrich, St. Louis, MO, USA), 0.8 μL of each primer (10 μM), and 2 μL of template DNA. The PCR program consisted of an initial denaturing step at 94 °C for 2 min, 30 amplification cycles (denaturing at 94 °C for 45 s, annealing at 50 °C for 45 s and extension at 72 °C for 50 s), and a final extension at 72 °C for 6 min, on a PCR System 9700 (Applied Biosystems). PCR products were purified using MultiScreen® filter plates (Millipore), labelled using BigDye® Terminator v.3.1 (Applied Biosystems) and sequenced on an ABI 3730 Genetic Analyser (Applied Biosystems) at the Scientific and Technological Centres of the University of Barcelona, Spain (CCiTUB). Other samples were directly sent for purification and sequencing to Macrogen Inc. (Seoul, South Korea). Sequences were edited and aligned using BioEdit® v.7.0.5.3 (Hall, 1999 ).
7
Genotyping of Transgenic Mouse Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All primers were provided by Thermo Fisher; the REDExtract-N-Amp PCR Reaction Mix™
(Sigma-Aldrich) and the MyFi™ DNA Polymerase (Meridian Bioscience) were used for the polymerase reaction. PCR genotyping was performed using the following sets of oligonucleotide primers: parvalbumin for Wt allele forward 5′-CAGAGCAGGCATGGTGACTA-3′, for Wt allele reverse 5′-AGT ACCAAGCAGGCAGGAGA-3′, for mutant allele forward 5′-GCGGTCTGGCAGTAAAAACTATC-3′, for mutant allele reverse 5′-GTGAAACAGCATTGCTGTCACTT-3′; Shank3 floxed forward 5′-GTCTCTGTGGTTGGGGTGTC-3′, reverse 5′-CAGTGAAGAAGCCCCAGAAG-3′ for both Wt and mutant allele; TdTomato for Wt allele forward 5′- AAGGGAGCTGCAGTGGAGTA-3′, for Wt allele reverse 5′-CCGAAAATCTGTGGGAAGTC-3′, for mutant allele forward 5′- CTGTTCCTGTACGGCATGG -3′, for mutant allele reverse 5′- GGCATTAAAGCAGCGTATCC -3′; Shank3Δ11−/− for Wt allele forward 5′-CAAGTTCATCGCTGTGAAGG-3′, for mutant allele forward 5′-CCTCTAGGCCTGCTAGCTGTT-3′, reverse 5′-AAGAAGCCCCAGAAGTGACA-3′ for both Wt and mutant allele.
(Sigma-Aldrich) and the MyFi™ DNA Polymerase (Meridian Bioscience) were used for the polymerase reaction. PCR genotyping was performed using the following sets of oligonucleotide primers: parvalbumin for Wt allele forward 5′-CAGAGCAGGCATGGTGACTA-3′, for Wt allele reverse 5′-AGT ACCAAGCAGGCAGGAGA-3′, for mutant allele forward 5′-GCGGTCTGGCAGTAAAAACTATC-3′, for mutant allele reverse 5′-GTGAAACAGCATTGCTGTCACTT-3′; Shank3 floxed forward 5′-GTCTCTGTGGTTGGGGTGTC-3′, reverse 5′-CAGTGAAGAAGCCCCAGAAG-3′ for both Wt and mutant allele; TdTomato for Wt allele forward 5′- AAGGGAGCTGCAGTGGAGTA-3′, for Wt allele reverse 5′-CCGAAAATCTGTGGGAAGTC-3′, for mutant allele forward 5′- CTGTTCCTGTACGGCATGG -3′, for mutant allele reverse 5′- GGCATTAAAGCAGCGTATCC -3′; Shank3Δ11−/− for Wt allele forward 5′-CAAGTTCATCGCTGTGAAGG-3′, for mutant allele forward 5′-CCTCTAGGCCTGCTAGCTGTT-3′, reverse 5′-AAGAAGCCCCAGAAGTGACA-3′ for both Wt and mutant allele.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!