Iq5 pcr thermocycler

Cell samples were sorted into 5.0 μl CellsDirect (Invitrogen) lysis buffer containing 4.25 μl Resuspension Buffer, 0.25 μl Lysis Enhancer and 0.5 μl RNase out. Note that (i) all heating steps were performed in an iQ5 PCR thermocycler (Bio-Rad); (ii) after sorting, each tube was immediately sealed and heated to 75°C for 10 min and either immediately processed or frozen at –80°C; (iii) processed samples were incubated at room temperature for 10 min with 2.5 μl DNase I (Invitrogen) and 0.8 μl DNase I buffer (Invitrogen) to remove genomic DNA. After the DNase step, 0.6 μl of 25 mM EDTA was added to the sample, and each tube was heated to 70°C for 5 min to inactivate the enzyme. cDNA was reverse transcribed using a mix of random primers and oligo(dT)20 (1 μl oligo(dT)20 at 50 μM, 0.6 μl random primers at 75 ng/μl, 0.5 μl 10 mM dNTPs) and each tube was heated to 70°C for 5 min. After priming, RT was initiated by adding 3 μl RT buffer, 0.5 μl RNaseOut, 1.0 μl SuperScript III RT and 1.0 μl DTT to each tube (25°C for 10 min, 50°C for 60 min, 85°C for 5 min). Samples were subsequently stored at –20°C. RNase-free solutions as well as sterile, disposable lab ware were used for all RNA processing steps.

Total RNA was extracted according to the manufacturer‘s instructions with Total RNA BioTeke (TaKaRa) then cDNA was synthesized with PrimeScriptTM RT reagent Kit (TaKaRa). cDNA was amplified by qPCR with SYBR Premix Ex TaqTM Ⅱ (TaKaRa) on a Bio-Rad iQ5 PCR thermocycler. The CT values were measured and calculated by computer software (Bio-Rad IQ5 Date Analysis), and the transcriptional level was calculated by formula the 2-△△CT formula. The following primers were used:

Primer	Sequence (5′to3′)
Fpn1F	GCCTTGTTCGGACTGGTCTGTTC
Fpn1R	CCAGGCATGAACACGGAGATCAC
DMT1F	CCTGTGGCTAATGGTGGAGTTGG
DMT1R	GGAGATTGATGGCGATGGCTGAC
β-actin-F	GGAGATTACTGCCCTGGCTCCTA
β-actin-R	GACTCATCGTACTCCTGCTTGCTG