miR-320a mimic, mimic control, pcDNA3.1 empty vector and IL-4 overexpressing plasmid (pcDNA3.1-IL-4) were purchased from GenePharma Co., Ltd. The mimic control and pcDNA3.1 empty vector were used as negative controls for miR-320a mimic and pcDNA3.1-IL-4, respectively. The sequences of miR-320a mimic and mimic control were as follows: miR-320a mimic, 5′-AAAAGCUGGGUUGAGAGGGCGA-3′; mimic control, 5′-UUCUCCGAACGUGUCACGUTT-3′. For transfection, HTR-8/SVneo cells were inoculated in six-well plates at a density of 105 cells/well, and were cultured in a humidified atmosphere with 5% CO2 at 37°C overnight. Transient transfections of 100 pmol miR-320a mimic, 100 pmol mimic control, 2.5 µg pcDNA3.1 empty vector and 2.5 µg pcDNA3.1-IL-4 vector were performed using Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) at 70–80% confluency according to the manufacturer's protocol. Cells were collected at 48 h after transfection for RT-qPCR analysis.
Pcdna3.1 empty vector
Manufactured by GenePharma
Sourced in China
PcDNA3.1 is an empty vector commonly used in molecular biology research. It serves as a backbone for the cloning and expression of foreign DNA sequences in mammalian cell lines. The vector contains essential elements for DNA replication and selection in both bacterial and mammalian cells.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine 2000, by Thermo Fisher Scientific (26 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (5 mentions)
Rpmi 1640 medium, by Thermo Fisher Scientific (4 mentions)
Sh nc, by GenePharma (3 mentions)
Inhibitor nc, by GenePharma (3 mentions)
Lipofectamine 3000 reagent, by Thermo Fisher Scientific (3 mentions)
Penicillin, by Thermo Fisher Scientific (3 mentions)
Streptomycin, by Thermo Fisher Scientific (3 mentions)
Pcdna3.1 tmpo as1, by GenePharma (2 mentions)
Mimic nc, by GenePharma (2 mentions)
Nc mimics inhibitor, by GenePharma (2 mentions)
Lipofectamine 3000 transfection reagent, by Thermo Fisher Scientific (2 mentions)
Lipofectamine 2000 reagent, by Thermo Fisher Scientific (2 mentions)
Anti mir nc, by RiboBio (2 mentions)
Pcdna3.1 h19, by GenePharma (2 mentions)
Si nc, by GenePharma (2 mentions)
Mir nc, by GenePharma (2 mentions)
Sh flvcr1 as1 1 2, by GenePharma (1 mentions)
Pcdna3.1 ctnnb1, by GenePharma (1 mentions)
Mir 381 3p mimics, by GenePharma (1 mentions)
39 protocols using pcdna3.1 empty vector
1
Modulating miR-320a and IL-4 in HTR-8/SVneo cells
2
FLVCR1, MYC, and β-catenin regulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SKBR3 and MCF7 cells were transfected with specific shRNAs against FLVCR1 (sh-FLVCR1-AS1#1#2), MYC (sh-MYC) and negative control (shCtrl), as well as pcDNA3.1/CTNNB1, pcDNA3.1/MYC and the empty pcDNA3.1 vector (all purchased from GenePharma, Shanghai, China), separately. The miR-381-3p mimics, miR-381-3p inhibitor, NC mimics and NC inhibitor were simultaneously constructed by GenePharma. Transfection was conducted for 48 h in light of the protocol of Lipofectamine2000 (Invitrogen)
3
miRNA and MyD88 Modulation in HaCaT Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For miRNA transfection, miR-145 mimic, miR-145 inhibitor, and the negative
control (Scramble) were synthesized by GenePharma Co. (Shanghai, China) and were
applied to alter the expression of miR-145 in HaCaT cells. HaCaT cells were
transfected with those vectors through using Lipofectamine 3000 reagent (Life
Technologies Corporation, Carlsbad, CA, USA) following manufacturer’s
instructions and incubated for 48 h. Then, the transfected cells were generated
and used for the following experiments.
For the overexpression of MyD88, the full-length MyD88 sequences were ligated
into empty pcDNA3.1 vector (GenePharma) to form the MyD88-overexpressing vectors
and were referred to as pc-MyD88. The empty pcDNA3.1 was served as a negative
control of pc-MyD88. Then, HaCaT cells were transfected with either pc-MyD88 or
empty pcDNA3.1 through using Lipofectamine 3000 reagent (Life Technologies
Corporation) on the basis of manufacturer’s protocol. After transfection for
48 h, cells were harvested and employed for subsequent experiments.
control (Scramble) were synthesized by GenePharma Co. (Shanghai, China) and were
applied to alter the expression of miR-145 in HaCaT cells. HaCaT cells were
transfected with those vectors through using Lipofectamine 3000 reagent (Life
Technologies Corporation, Carlsbad, CA, USA) following manufacturer’s
instructions and incubated for 48 h. Then, the transfected cells were generated
and used for the following experiments.
For the overexpression of MyD88, the full-length MyD88 sequences were ligated
into empty pcDNA3.1 vector (GenePharma) to form the MyD88-overexpressing vectors
and were referred to as pc-MyD88. The empty pcDNA3.1 was served as a negative
control of pc-MyD88. Then, HaCaT cells were transfected with either pc-MyD88 or
empty pcDNA3.1 through using Lipofectamine 3000 reagent (Life Technologies
Corporation) on the basis of manufacturer’s protocol. After transfection for
48 h, cells were harvested and employed for subsequent experiments.
4
Modulating MAPK1 and KCNQ1OT1 with shRNA and miR-212-3p in HK-2 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Short hairpin RNA (sh-RNA) targeting MAPK1 (sh-MAPK1) or KCNQ1OT1 (sh-KCNQ1OT1) and negative controls (sh-NC), MAPK1 overexpression vector (pcDNA3.1/MAPK1) and the negative control (empty pcDNA3.1 vector), miR-212-3p mimics/inhibitor and the negative control (NC mimics/inhibitor) were obtained from GenePharma (Shanghai, China). Sequences of plasmids used for cell transfection are provided in Table 1 . HK-2 cells were seeded in 6-well plates and grown for 24 h until the cell density reached 30–50%. Later, Lipofectamine 2000 (Thermo Fisher Scientific, USA) was used to transfect shRNAs (50 nM), mimics/inhibitors (40 nM) and pcDNA3.1 vectors (10 nM) into HK-2 cells according to the manufacturer’s protocols. After 48 hours, the efficiency of cell transfection was verified by RT-qPCR.
Sequences of plasmids used for cell transfection
| Name | Sequence (5ʹ→3ʹ) |
| sh-MAPK1 | GGACCTCATGGAAACAGATCTTTCAAGAGAAGATCTGTTTCCATGAGGTCCTTTTTT |
| sh-NC | AGATGACACTATAGGTCCGACTTCAAGAGAGTCGGACCTATAGTGTCATCTTTTTTT |
| sh-KCNQ1OT1 | GGTGTTACGACTTGTTGTATTCAAGAGATACAACAAGTCGTAACACC TTTTTT |
| sh-NC | GATGTGATCATTCTGGTGTTTCAAGAGAACACCAGAATGATCACATCTTTTTT |
| miR-212-3p mimics | UAACAGUCUCCAGUCACGGCC |
| NC mimics | CGCCACCUAAGUAGUGCACCU |
| miR-212-3p inhibitor | GGCCGUGACUGGAGACUGUUA |
| NC inhibitor | AGGUGCACUACUUAGGUGGCG |
5
Lung Cell Line Transfection Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A normal human lung epithelial cell line (BEAS-2B) and NSCLC cell lines (H1650, H460 and A549; all from the China Infrastructure of Cell Line Resource) were cultured in RPMI-1640 basic medium containing 10% fetal bovine serum, 100 mg/ml streptomycin and 100 U/ml penicillin (all from Gibco; Thermo Fisher Scientific, Inc.) in an incubator with 5% CO2 at 37°C.
Short hairpin RNA targeting CYTOR (sh-CYTOR), miR-206 mimics, miR-206 inhibitor, mimics-negative control (NC), inhibitor-NC, overexpression vector for PTMA (pcDNA3.1-PTMA) and NC (empty pcDNA3.1 vector; Shanghai GenePharma Co., Ltd.) were transfected with Lipofectamine® 3000 (Invitrogen; Thermo Fisher Scientific, Inc.) following the manufacturer's protocol to generate stably transfected cells (30 (link)). The plasmids and sequence information are provided inTable SII .
Short hairpin RNA targeting CYTOR (sh-CYTOR), miR-206 mimics, miR-206 inhibitor, mimics-negative control (NC), inhibitor-NC, overexpression vector for PTMA (pcDNA3.1-PTMA) and NC (empty pcDNA3.1 vector; Shanghai GenePharma Co., Ltd.) were transfected with Lipofectamine® 3000 (Invitrogen; Thermo Fisher Scientific, Inc.) following the manufacturer's protocol to generate stably transfected cells (30 (link)). The plasmids and sequence information are provided in
6
Targeting FGD5-AS1 and FGFRL1 in Lung Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Specific shRNAs against FGD5-AS1 (sh-FGD5-AS1#1#2) and the negative control (shNC) were gained from GenePharma (Shanghai, China). The pcDNA3.1/FGFRL1 and the empty pcDNA3.1 vector (GenePharma) were used for overexpression studies. The miR-107 mimics and NC mimics were obtained from GenePharma. And these plasmids were transfected into NCI-H1703 and NCI-H1793 cells by Lipofectamine 2000 (Invitrogen). Sequences for above plasmids were:
sh-NC: 5′-CCGGTTGAAAAAAGGGGGAAAAAAACTCGAGTTTTTTTCCCCCTTTTTTCAATTTTTG-3′
sh-FGD5-AS1#1: 5′-CCGGCACTTGATATTAGTAATTTGACTCGAGTCAAATTACTAATATCAAGTGTTTTTG-3′
sh-FGD5-AS1#2: 5′-CCGGGGCATGGTAAAAGAGTTAACTCTCGAGAGTTAACTCTTTTACCATGCCTTTTTG-3′
NC-mimics: 5′-ACGUCGAAUGUACAGGGCUAUCA-3′
hsa-miR-107 mimics: 5′-AGCAGCAUUGUACAGGGCUAUCA-3′
7
Investigating circ-ABCB10 and AK4 in A549 and NCI-H292 cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A549 and NCI-H292 cells were transfected with specific shRNAs against circ-ABCB10 (sh-circ-ABCB10#1#2), AK4 (sh-AK4#1#2), negative control (sh-NC), pcDNA3.1/AK4 or the empty pcDNA3.1 vector (GenePharma, Shanghai, China), separately. The miR-556-3p mimics and NC mimics were gained from GenePharma. Each plasmid was transfected into cells by Lipofectamine 2000 (Invitrogen).
8
TLR4 Overexpression in Rat Mesangial Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Rat glomerular mesangial cell line (HBZY-1) was obtained from Boster Biological Technology Co., Ltd. (Wuhan, China) and maintained in Dulbecco’s modified Eagle’s medium (DMEM) containing 10% fetal bovine serum (FBS) at 37°C. The TLR4 overexpression plasmid pcDNA3.1-TLR4 and empty pcDNA3.1 vector were purchased from GenePharma (Shanghai, China). Transfection of pcDNA3.1-TLR4 and pcDNA3.1 vector was performed using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, United States) according to the manufacturer’s instructions. At 48 h after transfection, western blot was performed to determine transfection efficiency.
9
Transfection and Functional Analysis of LANCL1-AS1 and miR-3680-3p in NSCLC Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human normal bronchial epithelial cell line (HBE) and NSCLC cell lines (A549, H1299, and H460) were obtained from the Cell Bank of Chinese Academy of Sciences (Shanghai, China) and incubated in RPMI-1640 medium (Gibco, Waltham, MA, USA) containing 10% fetal bovine serum (FBS; Invitrogen, Carlsbad, CA, USA), 100 U/mL penicillin, and 100 mg/mL streptomycin (Gibco) at 37°C with 5% CO2 in a humidified incubator. For cell transfection, pcDNA3.1/LANCL1-AS1 and empty pcDNA3.1 vector were synthesized by GenePharma (Shanghai, China) for overexpression assays. For the downregulation of miR-3680-3p and glia maturation factor gamma (GMFG), miR-3680-3p inhibitor or the negative control (NC inhibitor) and short hairpin RNAs targeting GMFG (sh-GMFG#1/2) or sh-NC were also obtained from RiboBio (Guangzhou, China). The above vectors were transfected into A549 and H460 cells, respectively using Lipofectamine 2000 (Invitrogen). Cells transfected for 48 h were used for subsequent analysis.
10
Investigating BBOX1-AS1, HuR, and HOXC6 in SiHa and HeLa cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SiHa and HeLa cells were transfected with the specific short hairpin RNAs to BBOX1‐AS1 (sh‐BBOX1‐AS1#1#2), HuR (sh‐HuR#1#2), HOXC6 (sh‐HOXC6#1#2) and the negative control (sh‐NC), as well as pcDNA3.1/BBOX1‐AS1, pcDNA3.1/HOXC6 and the empty pcDNA3.1 vector (all acquired from GenePharma), separately. The miR‐361‐3p mimics and NC mimics were simultaneously obtained from GenePharma. Lipofectamine 2000 (Invitrogen) was applied for cell transfection for 48 hours.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!