Mmessage mmachine t7 ultra transcription kit

The Fz4^MGK mouse was generated using CRISPR/Cas9 gene editing. An sgRNA (AGGAAAAGGCAACGAGACTG) targeting exon 2 of Fz4 was selected and synthesized, as described by Pelletier et al. (2015) (link). Briefly, a dsDNA template containing the sequences for a T7 promoter, the sgRNA, and a tracrRNA scaffold was generated by tandem PCR amplification and purification on a Qiagen column (Qiagen 28106). In vitro transcription of this dsDNA template was performed using the MEGAshortscript T7 Kit (Invitrogen AM1354), and products were purified using the MEGAclear Transcription Clean-Up Kit (Invitrogen AM1908). The Cas9 mRNA was transcribed from a modified pX330 plasmid (Addgene 42230), which contains a T7 promoter (pX330+T7), using the mMESSAGE mMACHINE T7 Ultra Transcription Kit (Invitrogen AM1345). The transcript was purified by LiCl precipitation. The quality of all purified transcripts was confirmed using an Agilent 2100 Bioanalyzer. The sgRNA and Cas9 mRNA were injected into C57BL/6 x SJL F2 embryos and correctly targeted founders were identified by PCR and by sequencing of cloned PCR products.

To design single-guide RNAs (sgRNAs), the online program CRISPRscan (www.crisprscan.org) was used (Moreno-Mateos et al., 2015 (link)). The gRNAs were designed to target exons, except for exon 1, to be as close as possible to the transcription start site and to have no predicted off-target effects. The sgRNAs were generated from annealed primers, one containing a minimal T7 RNA polymerase promoter, the target sequence, and a tail-primer target sequence and a generic tail-end primer (Vejnar et al., 2016 (link)). To generate primer dimers, the FastStart™ High Fidelity PCR System from Sigma-Aldrich was used. A solution was prepared, containing 1 mM forward sgRNA oligonucleotide, 1 mM reverse oligonucleotide consisting of 20-nucleotide overlap with sgRNA oligonucleotide and the Cas9-binding part, 0.8 mM dNTPS, 1× FastStart Buffer and 6.25 U/µl FastStart Taq polymerase in 20 µl total volume. Annealed DNA oligonucleotide dimers were generated by denaturation at 95°C for 5 min followed by annealing by reducing the temperature by 1°C per second over 20 s to 75°C and extension at 72°C for 10 min. The gRNAs were synthetized from annealed DNA oligonucleotides, containing a minimal T7 RNA polymerase promoter, with the mMESSAGE mMACHINE™ T7 ULTRA Transcription Kit (Invitrogen), according to the manufacturer's instructions.