Samples were thawed and cut into smaller pieces in case of brain tissue. DNA was extracted using RTP Pathogen Kit (STRATEC, USA). Each extract was tested for all ten pathogens by amplifying species-specific gene sequences using species-selective primers. All primers used in this study were designed in-house using the Primer-BLAST tool for finding primers specific to the polymerase chain reaction (PCR) template (Table 1).
Rtp pathogen kit
Manufactured by Stratec
Sourced in Germany
The RTP Pathogen Kit is a laboratory equipment product designed for the rapid detection and identification of pathogens. It utilizes a real-time PCR (Polymerase Chain Reaction) technology to amplify and detect specific genetic sequences associated with various microorganisms. The core function of the RTP Pathogen Kit is to provide a reliable and efficient method for the analysis of samples for the presence of pathogenic agents.
Automatically generated - may contain errors
10 protocols using rtp pathogen kit
1
Multiplex Pathogen Detection Protocol
2
RNA Extraction and SARS-CoV-2 qPCR Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Viral RNA was extracted from the collected samples using STRATEC Molecular RTP® Pathogen Kit (Berlin, Germany) according to the manufacturer’s instructions. The extraction was carried out in a Bio-Safety Level-II (BSL-II) cabinet. The viral nucleic acid was stored in aliquots at −80 °C until use. Quantitative PCR (qPCR) was performed using a one-step RT-PCR kit (Invitrogen, USA) with a 25 µl reaction mixture containing 5 μl of RNA template, 12.5 µl 2× buffer, 1 µl enhancer, 1 µl 50× taq polymerase enzyme, 0.5 µl 100× forward primer, 0.5 µl 100× reverse primer, 0.5 µl 100× probe, 4 µl nuclease free water. The PCR cycling conditions consisted of an initial reverse transcriptase step at 50 °C for 30 min, followed by a 5 min hold at 95 °C, and then 45 cycles of 15 s at 95 °C and 30 s at 55 °C. Results were documented considering the relative cycle threshold (Ct) values with that of positive control. High Ct values (>38) were avoided. The primer sequences used for influenza A: Forward, GAC CRA TCC TGT CAC CTC TGA C; Reverse, AGG GCA TTY TGG ACA AAK CGT CTA; Probe, TGC AGT CCT CGC TCA CTG GGC ACG; Influenza B: Forward, TCC TCA AYT CAC TCT TCG AGC G; Reverse, CGG TGC TCT TGA CCA AAT TGG; Probe, CCA ATT CGA GCA GCT GAA ACT GCG GTG; RnaseP: Forward, AGA TTT GGA CCT GCG AGC G; Reverse, GAG CGG CTG TCT CCA CAA GT; Probe, TTC TGA CCT GAA GGC TCT GCG CG.
3
Multiplex rRT-PCR Respiratory Pathogen Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bacterial DNA and viral RNA/DNA was extracted from 400 μL of NP swabs with the RTP pathogen kit (Cat No: 1040500200, Stratec®). The genomes were subjected to quantitative multiplex real-time reverse transcription-polymerase chain reaction (rRT-PCR), for detection of respiratory viruses including human adenovirus, human bocavirus, human coronavirus (NL63, 229E, OC43 and HKU1229), enterovirus, influenza A virus, influenza A H1N1 virus, influenza B virus, human metapneumovirus A/B, human parainfluenza virus 1, 2, 3 and 4, human parechovirus, human rhinovirus, RSV A/B, and bacteria including Streptococcus pneumoniae, Staphylococcus aureus, Haemophilus influenzae type b, Chlamydia pneumoniae, and Mycoplasma pneumoniae as part of the FTD Respiratory pathogens 21 plus kit (Cat No: FTD-2 + .1–64, FTD Diagnostics®). Samples with cycle threshold (Ct) value ≤38 were considered positive. Bacterial loads were calculated using standards provided with the kit, in genomic copies/mL and Log10 transformed.
4
Whole Blood DNA Extraction Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted from 50 µl of whole blood of each sample, diluted in 350 µl double distilled water (DDW) using a commercial kit (RTP Pathogen Kit, Stratec, Germany), according to the manufacturer's instructions.
5
Isolation and Sequencing of a Mosquito-Borne Virus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The virus mix was isolated from one MeSV generic PCR-positive mosquito pool (consisting of 3 Cq. richiardii). The mosquitoes were collected on the island of Kühkopf in the state of Hesse in Germany during the 2014 field season using dry ice-baited EVS traps as well as gravid traps, BG-Sentinel traps, sweeping nets and hand-held aspirators. Mosquitoes were pooled together by species and homogenized in 1 ml of cell culture medium (high-glucose Dulbecco’s modified Eagles’s medium). RNA was extracted from the homogenates (400 µl) using the RTP Pathogen Kit (Stratec Biomedical AG, Birkenfeld, Germany), followed by a generic MeSV PCR using the SuperScript® III One-Step RT-PCR System with Platinum® (Life Technologies, Thermo Fisher Scientific) with corresponding primers (Additional file 1 : Table S1: MeSV-FW & RV) [19 ]. The isolation was performed on C6/36 cells, according to established protocols [19 , 20 ]. Briefly, the 1-ml mosquito pool homogenate was clarified by centrifugation, followed by the addition of the cleared supernatant onto C6/36 cells and incubation at 28 °C.
Following observation of cytopathic effects (CPE), the supernatant was passaged again on C6/36 cells to produce a virus working stock (named 8345), followed by virus discovery with a next-generation sequencing approach.
Following observation of cytopathic effects (CPE), the supernatant was passaged again on C6/36 cells to produce a virus working stock (named 8345), followed by virus discovery with a next-generation sequencing approach.
6
Multiplex RT-PCR for Influenza A/B Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from oropharyngeal swabs with the RTP Pathogen Kit (Stratec biomedical, Birkenfeld, Germany) and eluted in 120 μL. Screening of samples for influenza A and B was conducted with the RealStar® Influenza RT‐PCR Kit 1.0 (Altona Diagnostics, Hamburg, Germany) as described by the manufacturer with half the reaction volume. Positive influenza A samples were further differentiated for A(H1N1)pdm09 and A(H3N2) following the real‐time RT‐PCR protocol recommended by the WHO.13 PCRs were performed in 25 μL using the Superscript® III OneStep RT‐PCR with Platinum Taq DNA Polymerase (Invitrogen, Karlsruhe, Germany) containing 5.0 μL RNA template, 5.5 μL water, 12.5 μL 2× reaction buffer, 40.0 μmol/L of each forward (A(H3N2): 5′‐AGCAAAGCCTACAGCAA‐3′, A(H1N1)pdm09: 5′‐GAGCTAAGAGAGCAATTGA‐3′) and reverse (A(H3N2): 5′‐GACCTAAGGGAGGCATAA‐3′, A(H1N1)pdm09: 5′‐GTAGATGGATGGTGAATG‐3′) primer, 10.0 μmol/L probe (H3N2: 5′‐Fam‐CCGGCACATCATAAGGGTAACA 3′‐BHQ‐1, A(H1N1)pdm09: 5′Fam ‐TTGCTGAGCTTTGGGTATGA ‐3′‐BHQ‐1), and 0.5 μL enzyme. Conditions for the reverse transcription PCR were 50°C for 30 minutes, followed by 2 minutes of initial denaturation at 95°C and 45 cycles at 95°C for 15 seconds and 55°C for 30 seconds.
7
Serum Nucleic Acid Extraction Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Nucleic acid extraction was conducted applying the RTP Pathogen Kit (Stratec Molecular, Birkenfeld, Germany) with 200µL serum volumes, as described by the manufacturer. The eluates were stored at −80 °C prior to real-time PCR analysis.
8
Multiplex Real-Time PCR for Respiratory Pathogens
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bacterial and viral DNAs as well as viral RNA were extracted from the nasopharyngeal swabs using RTP® Pathogen kit (STRATEC Molecular, Germany). A multiplex real-time PCR assay allowing the identification of 22 respiratory pathogens (Fast-track Diagnostics respiratory pathogens kit, FTD Luxembourg) was used as previously described [13 (link)]. Following nucleic extraction of EDTA-whole blood samples, another multiplex real-time PCR assay was performed to identify Staphylococcus aureus, Streptococcus pneumoniae and Haemophilus influenzae type b as previously described [14 (link)]. All RNA/DNA amplifications and detections were done using Bio-Rad CFX96 machine (Bio-Rad, USA).
9
Blood and Tissue DNA Extraction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted from 50 µL of whole blood from each sample, diluted in 350 µL double distilled water (DDW) using a commercial kit (RTP Pathogen Kit, Stratec, Germany), according to the manufacturer’s instructions (mare samples from 2015); or from 100 µL of whole blood using a commercial kit (DNeast blood and tissue kit, QIAGEN, Hilden, Germany), in accordance with the manufacturer’s instructions (mares’ and foals’ samples from 2017). DNA from fetal tissues and placentas was extracted using the Maxwell® RSC instrument and extraction kit (Promega, Wisconsin, USA).
10
Nucleic Acid Isolation from Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Samples were thawed on ice and pulse vortexed 5 times. Total nucleic acid (including DNA and RNA) were then isolated using the RTP Pathogen kit per manufacturer’s protocol (Stratec Biomedical, Birkenfeld, Germany).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!