Dna engine opticon 2 two color qrt pcr detection system

For each sample, cells were lysed using TRIzol reagent (Invitrogen). Total RNA was isolated as described 10 (link) and was transcribed into cDNA using a reverse transcription kit (RR047A; TaKaRa, Japan). qPCRs were run using SYBR Green Master Mix (Life Technologies) in a DNA Engine Opticon 2 Two-Color qRT-PCR detection system (Bio-Rad Laboratories, Hercules, CA). Target gene expression was normalized to the level of GAPDH mRNA. The following primers were used: S-F, GGCTGCGTTATAGCTTGGAATT; S-R, GTGGGTTGGAAACCATATGATTG; GFP-F, CCGCATCGAGAAGTACGAGG; GFP-R, GCGGATGATCTTGTCGGTGA; GAPDH-F, TGCACCACCAACTGCTTAGC; GAPDH-R, GGCATGGACTGTGGTCATGAG; Cas13a-F, TGGAAAAGTACCAGTCCGCC; Cas13a-R, TCGAAGTCCT CGGTCACTCT; S'-F, TGGTATGTTTGGCTCGGCTT; S'-R, GCAGCAAGAAC CACAAGAGC.

Cells were lysed in TRIzol Reagent and mixed with chloroform, then centrifuged at 12000 rpm for 10 minutes at 4°C. The upper aqueous phase was transferred to a clean tube and an equal volume of isopropanol was added. The samples were mixed and stored at −20°C overnight. The concentration of total RNA was measured by NanoDrop 2000 (Thermo Scientific, USA). cDNA was synthesized from 1 µg of RNA using a reverse transcription kit (Promega, USA), according to the manufacturer’s protocol. qRT-PCR was performed using the DNA Engine Opticon 2 Two-Color qRT-PCR detection system (Bio-Rad Laboratories, USA) and the results were normalized to the GAPDH. The following primers were used: