We carried out Sanger sequencing on a subset of tumors from the discovery cohort to confirm the mutations found in RAS-positive samples. The PCR reaction included 1 μL of cDNA or 50 ng of DNA, 0.2 μM of each specific primer, 1.5-mM MgCl2, 0.8-mM dNTP mix and 2 units of Platinum Taq DNA polymerase (Invitrogen) in a 25-μL final volume. The amplified products were analyzed by gel electrophoresis on a 2.0% agarose gel, visualized in the Gel Doc EZ system (Bio-Rad, Hercules, CA, USA) and purified using illustra ExoProStar S (GE Healthcare, Waukesha, WI, USA). Sequencing was performed with the Big Dye TerminatorCycle v3.1 Sequencing Ready Reaction kit in the ABI 3130 platform, according to the manufacturer’s instructions (Applied Biosystems, Foster City, CA, USA). All samples were sequenced at least twice.
Abi3130 platform
Manufactured by Thermo Fisher Scientific
Sourced in United States
The ABI3130 platform is a capillary electrophoresis system designed for DNA sequencing and fragment analysis applications. It features a multi-capillary design and utilizes laser-induced fluorescence detection technology.
Automatically generated - may contain errors
Lab products found in correlation
Platinum taq dna polymerase, by Thermo Fisher Scientific (1 mentions)
Gel doc ez system, by Bio-Rad (1 mentions)
Gotaq probe 1 step rt qpcr system, by Promega (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Qiamp viral rna mini kit, by Qiagen (1 mentions)
Sybr gold nucleic acid gel stain, by Thermo Fisher Scientific (1 mentions)
Pgem t easy plasmid vector, by Promega (1 mentions)
4 protocols using abi3130 platform
1
Sanger Sequencing of RAS Mutations
2
Yellow Fever Virus RNA Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For each NHP (n = 10), fragments of 30 mg of the liver were used in total RNA extraction, using RNeasy Mini Kit (Qiagen, USA). From human samples, total RNA was extracted using 140 μL of serum (n = 3, sera collected in 2018) or infected cell supernatant (n = 3, sera collected in 2017), using QIAmp Viral RNA Mini Kit (Qiagen, USA). YFV RNA investigation was performed by real-time PCR preceded by reverse transcription (RT-qPCR), using GoTaq Probe 1-Step RT-qPCR System (Promega) and primers and probe described by Domingo and colleagues (2012) [14 (link)]. Using specific primers, targeting CprM and envelope regions of the YFV genome [15 (link)], partial sequences were amplified and sequenced by dideoxy-method on an ABI3130 platform (Applied Biosystems). Raw data were analyzed and final contigs were assembled using SeqTrace [16 (link)].
3
Amplification and Sequencing of A56R and C11R Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Positive samples that could be reamplified (A56R-positive) or amplified by a conventional PCR targeting C11R (C11R-positive) (26 (link)) were chosen for sequencing. For A56R, product from the previous reaction was reamplified in a conventional PCR reaction using 1 μL of the first reaction as input and 0.2 nmol/L (A56R) rPCR primers. PCR cycling for A56R gene consisted of 10 min at 95°C for denaturation, 30 cycles of denaturation (95°C for 10 min), annealing (60°C for 60 s), extension (72°C for 60 s), and a final extension of 10 min at 72°C. Products with single bands were directly sequenced, and products with multiple bands had the target gene extracted from acrylamide gels stained with SYBR Gold Nucleic Acid Gel Stain (Invitrogen) and had its DNA purified. Nucleotide sequencing was performed by dideoxy method in an ABI3130 platform (Applied Biosystems), and sequence quality was analyzed by using Sequence Scanner Software 1.0 (Applied Biosystems). Sequences were aligned with other reference sequences from the BLAST nucleotide database (http://blast.ncbi.nlm.nih.gov/Blast.cgi ) by using MEGA 6.0; the same program was used for identity matrix construction (27 (link)).
4
Isolation and Characterization of Saimiri Satellite DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Isolation of alpha satDNA was performed through polymerase chain reaction (PCR) of Saimiri genomic DNAs using the following specific primer set: alpha-F (ACAGGGAAATATCTGCTTCTAAATC) and alpha-R (GCTTACTGCTGTTTCTTCCATATG). The thermocycling conditions were as follows: 95 °C—3 min, 35 cycles: 95 °C—30 sec; 60 °C—30 sec; 72 °C—1 min; final elongation: 72 °C—3 min. The repeat monomers obtained by PCR were cloned into pGEM-T Easy vector plasmids (Promega) and used to transform E. coli strain XL1-BLUE (Phoneutria) through electroporation. Recombinant colonies were capillary sequenced with the ABI3130 platform (Applied Biosystems) and are available in GenBank under accession numbers MK879580-MK879592. We obtained three sequenced clones from S. sciureus, five from S. vanzolinii and five from S. ustus. These sequenced clones were used in molecular analyses and as FISH probes. CapA amplification was performed using genomic DNAs from S. boliviensis and S. vanzolinii and the primer set CapA-F (ACTTCCTCACTGACCTGTCTT) and CapA-R (GGGCTGATGCTTAATGTAGCA). CapA isolation and cloning were previously performed in Valeri et al.31 (link) using human DNA and the same primer set described. The sequenced product is deposited in GenBank under the accession number MG264524 and was used as a FISH probe in this study.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!