Circulating cells from 10 larvae were isolated in 20 μL of 1× PBS for each biological replicate and total RNA was extracted using the PureLink RNA mini kit (Ambion) and quantitated using a spectrophotometer (Implen). The SuperScript III First-Stand synthesis SuperMix kit (Invitrogen) and 150 ng of RNA was used for cDNA synthesis and relative quantitative PCR was performed by comparative CT method using Power SYBR Green PCR master mix kit (Applied Biosystems) with a StepOne Real-Time PCR detection thermal cycler (Applied Biosystems). Primers used in this study were either from published literature or designed using Primer3, and the expression level of RpL32 was used to normalize total cDNA input in each experiment. Primer sequences (5′–3′) are as follows: Drs: (forward) CGTGAGAACCTTTTCCAATATGA, (reverse) TCCCAGGACCACCAGCAT; Mmp1: (forward) GGCAGAGGCGGGTAGATAG, (reverse) TTCAGTGTTCATAGTCGTAGGC; upd: (forward) AACTGGATCGACTATCGCAAC, (reverse) CTATGGCCGAGTCCTGGCTAC; upd2: (forward) CCAGCCAAGGACGAGTTATC, (reverse) GCTGCAGATTGCCGTACTC; upd3: (forward) ACAAGTGGCGATTCTATAAGG, (reverse) ATGTTGCGCATGTACGTGAAG; mys: (forward) GATCACGGTACATGCGAGTG, (reverse) GTACCATGACCGGAGCAGAT; chinmo: (forward) CAGTGCCAATGAGGCTAATG, (reverse) TCAAGTTCTCCAGCTTCACG; Rpl32: (forward) GACGCTTCAAGGGACAGTATCT, (reverse) AAACGCGGTTCTGCATGAG.
Superscript 3 first stand synthesis supermix kit
Manufactured by Thermo Fisher Scientific
The SuperScript III First-Strand Synthesis SuperMix kit is a reagent system used for the reverse transcription of RNA into cDNA. It contains everything needed to efficiently generate first-strand cDNA from total RNA or poly(A)+ RNA.
Automatically generated - may contain errors
Lab products found in correlation
Power sybr green pcr master mix kit, by Thermo Fisher Scientific (2 mentions)
Purelink rna mini kit, by Thermo Fisher Scientific (2 mentions)
Stepone real time pcr detection thermal cycler, by Thermo Fisher Scientific (2 mentions)
Mx3000p qpcr system, by Agilent Technologies (1 mentions)
Kapa sybr fast qpcr kit, by Roche (1 mentions)
Allprep dna rna mini kit, by Qiagen (1 mentions)
Turbo dna free kit, by Thermo Fisher Scientific (1 mentions)
Rneasy plus mini kit, by Qiagen (1 mentions)
Abi prism 7000 sequence detection system, by Thermo Fisher Scientific (1 mentions)
4 protocols using superscript 3 first stand synthesis supermix kit
1
Quantifying Gene Expression in Drosophila Larvae
2
Quantitative Analysis of Biofilm Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from 40 Petri dishes containing biofilms using the ALLPrep DNA/RNA Mini Kit (Qiagen, Hilden, Germany). To remove potential DNA contamination, the TURBO DNA-free TM Kit was applied (Applied Biosystems, Foster City, CA). Subsequently, RNA was reverse transcribed into first-strand cDNA using the SuperScript III First-Stand Synthesis SuperMix Kit (Invitrogen, Carlsbad, CA) and random hexamers. The qPCR reactions were conducted using the Kapa SYBR Fast qPCR Kit (Kapa Biosystems, Woburn, MA) on a Mx3000P qPCR System (Agilent Technologies, Palo Alto, CA). Each 20-μl qPCR reaction contained 10 μl of 2 × Master Mix, 1 pmol/μl of forward and reverse primers, and 0.5 μl of either standard or environmental sample. The cycling parameters were 5 min at 95°C, followed by 40 cycles of 15 s at 95°C, 15 s at 50°C and 15 s at 60°C. The 16S rRNA gene was used as an internal standard in qPCR, and the fold change of one target gene from different biofilm stages was calculated by normalizing its Ct values to the Ct values of the 16S rRNA gene. Three experimental replicates (technical replicates that started from cDNA synthesis) were performed. The primers used in this study are listed in Supplementary Table 2 .
3
Quantitative analysis of HERV-K expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cultured cells with RNeasy Plus mini kit (Qiagen) and treated with RNase-free DNase. Reverse transcription was performed with 500 ng RNA using Superscript III first stand synthesis Supermix kit (Invitrogen). Gene expression levels for HERV-K gag and glyceraldehyde 3-phosphotate dehydrogenase (GAPDH) were determined by quantitative PCR performed on an ABI PRISM 7000 Sequence Detection System (Applied Biosystem, Carlsbad, California). PCR primers are listed in Table 2 . Absence of DNA contamination in the RNA preparation was confirmed when target gene was not detected by PCR when RT was omitted during reverse transcription. The amount of RNA was expressed as fold change using GAPDH as an internal standard.
PCR primers
| Target gene | Primer sequence (5′–3′) |
|---|---|
| HERV-K env | Forward: CTGAGGCAATTGCAGGAGTT |
| Reverse: GCTGTCTCTTCGGAGCTGTT | |
| HERV-K gag | Forward: AGCAGGTCAGGTGCCTGTAACATT |
| Reverse: TGGTGCCGTAGGATTAAGTCTCCT | |
| GAPDH | Forward: TGCACCACCAACTGCTTAGC |
| Reverse: GGCATGGACTGTGGTCATGAG | |
| MS2 | Forward: TCCTGCTCAACTTCCTGTCGA |
| Reverse: CACAGGTCAAACCTCCTAGGAATG | |
| Probe: [6FAM]CGAGACGCTACCATGGCTATCGCTGTAG[TAM] |
4
Quantitative PCR of Wing Disc RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from approximately forty 3rd instar larval wing discs using PureLink RNA mini kit (Ambion, Waltham, MA ). The SuperScript III First-Stand synthesis SuperMix kit (Invitrogen) was used for first-stand cDNA synthesis. Relative quantitative PCR was performed by comparative CT method using Power SYBR Green PCR master mix kit (Applied Biosystems, Waltham, MA ) and a StepOne Real-Time PCR detection thermal cycler (Applied Biosystems). The levels of RpL10 were used to normalize total cDNA input.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!