Based on the previous transcriptome data of R. pseudostellariae in our laboratory (Qin et al., 2017 (link)), nine primer pairs were used (
Sybr green qpcr master mix
SYBR Green qPCR Master Mix is a ready-to-use solution for quantitative real-time PCR (qPCR) analysis. It contains SYBR Green I dye, which binds to double-stranded DNA and emits a fluorescent signal that can be detected during the PCR process. The master mix includes all the necessary components for the qPCR reaction, including DNA polymerase, dNTPs, and buffer.
Lab products found in correlation
10 protocols using sybr green qpcr master mix
Quantitative Analysis of Defense Gene Expression in Radix pseudostellariae
Based on the previous transcriptome data of R. pseudostellariae in our laboratory (Qin et al., 2017 (link)), nine primer pairs were used (
Quantifying pre-rRNA expression in cell lines
Renal Tissue Nrf2 and HO-1 Expression
Oxidative Stress and Immune Gene Expression in Zebrafish
Total RNA was extracted from the liver of zebrafish using TransZol Up Plus RNA Kit (TransGen, Beijing, China) according to the manufacturer’s instructions. The purity and concentration of total RNA were detected using an ultra-micro spectrophotometer (Thermo NanoDrop 2000, Waltham, MA, United States). RNA was reverse transcribed into cDNA using TransScript All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (TransGen, Beijing, China). The qPCR was performed with cDNA as a template by the intercalation fluorescence method to obtain the PCR melting curve. Ten microliter of the reaction mixtures consisted of 5 μl SYBR Green qPCR Master Mix (TransGen, Beijing, China), 1 μl of forward primer, 1 μl of reverse primer, and 3 μl of ddH2O. The relative mRNA expression levels were calculated by the 2-ΔΔCT method (Schmittgen and Livak, 2008 (link)). Primer sequences for the reference gene (β actin) and immune-related genes are shown in
Quantitative Real-Time PCR Analysis of Gene Expression
Primers used in the RT-qPCR
Gene | Forward | Reverse |
---|---|---|
MEX3C | GAAAGAGCGTCAACACCACC | AAATGGGCTCTTCACCACGA |
RUNX3 | AGCACCACAAGCCACTTCAG | GGGAAGGAGCGGTCAAACTG |
Suv39H1 | CCTGCAGGTGTACAACGTCT | ATCAAAGGTGAGCTCCTCGC |
CEA | TTACCTTTCGGGAGCGAACC | GTGTGTGTTGCTGCGGTATC |
SCCAg | GATGCAGACCTCTCAGGCAT | AATCCTACTACAGCGGTGGC |
Ki-67 | GGAAGCTGGACGCAGAAGAT | CAGCACCATTTGCCAGTTCC |
PCNA | CCTGAAGCCGAAACCAGCTA | TGAGTGCCTCCAACACCTTC |
GAPDH | CCAGCAAGAGCACAAGAGGA | ACATGGCAACTGTGAGGAGG |
Quantifying Firefly Luciferase Expression
Quantifying MELK Expression in Porcine Tissues
Quantifying Gene Expression in Mouse Colon Tissue
reagent (TransGen Biotech, China) was used to lyse the 50 mg sample
of mouse colon tissue to extract the RNA. The ratio of the absorbance
at 260 nm to that at 280 nm was then used to calculate the quantity
of extracted RNA. 1.0 g of total RNA was applied to synthesize complementary
DNA (cDNA) using a Thermo Scientific RevertAid First Strand cDNA Synthesis
Kit (Thermo Scientific, USA). The SYBR Green QPCR Master Mix (TransGen
Biotech, China) and a Bio-Rad CFX96 Real-Time PCR Detection System
(Bio-Rad Laboratories, USA) were applied to amplify cDNA. The target
gene’s mRNA expression was determined using the 2−ΔΔCt method, with GAPDH serving as the reference gene.
the RT-PCR primers.
Oxidized LDL-Induced Inflammation Modulation
Total RNA Extraction and RT-qPCR Analysis
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!