Sf9 cells

Sf9 cells (Invitrogen) were maintained in Sf-900 III SFM supplemented with 5% fetal bovine serum (Gibco) and 1X antibiotic antimycotic solution (Sigma). To generate stable Sf9 cells with WT gPrestin, Sf9 cells were transfected with pIZ-gPres-ceGFP using Effectene (Qiagen), and selected with 1 μg/μl zeocin (Invitrogen). A single clone was chosen to establish the stable cell line. The tetracycline-inducible WT-gPrestin stable HEK293 cell line (293-TRxST-gPrestin-YFP4TOmycHisC) was a generous gift from Drs. Santo-Sacchi and Navaratnam. Growth conditions and induction of the cell line were defined previously47 (link). For transient transfections of Sf9 and HEK293T cells with prestin constructs, Effectene (Qiagen) and jetPRIME (Polyplus) were used according to the manufacture’s instructions.

To generate pIZ-499-prestin-ceGFP, pIZ-gPres-ceGFP that contained full-length gerbil prestin with the C-terminal V5 and GFP tag in the pIZ-V5/His vector (Thermo Fisher) [45 (link)] was mutagenized using QuickChange Site-Directed Mutagenesis Kit (Agilent) following the manufacturer’s instructions. To introduce 499 mutations (V499G/Y501H) [58 (link)], the following primers were used: gPres V499A/Y501H A (5′- CATTGCTCTGCTGACTGGGATCCACAGAACCCAGAGTCC -3′) and gPres V499A/Y501H B (5′- GGACTCTGGGTTCTGTGGATCCCAGTCAGCAGAGCAATG -3′). Sf9 cells (Thermo Fisher) were maintained in Sf-900 III SFM supplemented with 5% fetal bovine serum (Gibco) and 1X antibiotic antimycotic solution (Sigma). To generate stable Sf9 cells expressing 499-prestin protein, Sf9 cells were transfected with pIZ-499-prestin-V5_ceGFP using Effectene (Qiagen), and selected with 1 μg/μl zeocin (Thermo Fisher). A single clone was chosen to establish the stable cell line. Generation of the stable sf9-prestin-ceGFP cell line, which expresses WT prestin, was previously reported [45 (link)].