Mcf 7
The MCF-7 is a cell line derived from human breast adenocarcinoma. It is widely used in cell biology research as a model system for studying various aspects of breast cancer.
Lab products found in correlation
2 protocols using mcf 7
Culturing Human Cancer Cell Lines
Circular RNA Regulation in Breast Cancer
Small interfering RNA (siRNA) targeting circ_0008812 (si-circ8812: ACGAGUGCACUUGGUGAAAUU), circ_0001583 (si-circ1583: CAAAGAAGGCCAAGGUUAAUU) and negative control (si-NC) were generated by Tsingke Biotechnology (Chengdu, China). MCF-7 cells were transfected using Lipofectamine 3000 (Invitrogen) for 48 h.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!