Shkifc1

The KIFC1 short hairpin RNAs (shRNAs; shKIFC1-1: 5′-CCGGTCCCTCAACTCTCTACGCTTTCTCGAGAAAGC GTAGAGAGTTGAGGGATTTTTG-3′ and shKIFC1-2: 5′-CCGGC TGTCACCAATGCTCGATATGCTCGAGCATATCGAGCATT GGTGACAGTTTTTG-3′) and CENPE overexpression (pcDNA-CENPE) plasmid together with their negative controls (shRNA and pcDNA) were purchased from GenePharma (Shanghai, China). The sequence of CENPE was amplified and inserted into the pcDNA3.1(+) vector. For transfection, SKOV3 cells were grown in a 6-well plate until 50% to 70% confluence, and then Lipofectamine 3000 (Thermo Fisher Scientific, Waltham, MA, USA) was used to transfect the specified vectors, according to the manufacturer’s instructions. Briefly, 50 pmol shRNAs and 1.5 μL Lipofectamine 3000 were diluted in 25 μL FBS-free DMEM, separately. After complete mixing, the 50 μL of transfection solution was added to the culture medium. At 48 h after transfection, the cells were ready for the experiments.

Human GC cell lines AGS, BGC-823, MKN-28, MKN-45, MGC-803, and SGC-7901 and human embryonic kidney 293 (HEK-293) cells were purchased from the Shanghai Institutes for Biological Sciences (Shanghai, People’s Republic of China) and routinely cultured in Roswell Park Memorial Institute 1640 medium (Invitrogen, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (HyClone, Logan, UT, USA), 100 U/mL penicillin, and 100 μg/mL streptomycin. All cells were maintained in a humidified incubator containing 5% carbon dioxide at 37°C.
The miR-135a mimics, miR-135a inhibitors, small-interfering RNAs targeting KIFC1 (siKIFC1), short-hairpin RNA expression vectors targeting KIFC1 (shKIFC1) and their respective controls were obtained from GenePharma (Shanghai GenePharma Co. Ltd, Shanghai, People’s Republic of China). The cells were seeded into six-well plates, incubated for 24 hours, and then transfected with miR-135a mimics, inhibitors, siKIFC1, or shKIFC1 by using Lipofectamine 2000 (Invitrogen), in accordance with the manufacturer’s suggestions. At 48 hours posttransfection, cells were harvested and used in subsequent experiments.