Pcdh puro cmyc

Lentivirus vector plasmids containing shRNA sequences for MSH6 were
TRCN0000286578 from Sigma (sh1) and V3LHS 318784 from Dharmacon (sh8).
Non-targeting shRNA lentivirus vector (SHC002) was from Sigma. Myc
overexpression construct, pCDH-puro-cMyc was from Addgene (#46970), and GFP
control was pCDH-CMV-MCS-EF1-copGFP from System Bioscience (CD511B-1). For
regulatable Myc knockdown, cMyc-shRNA sequences (No.1:
CCGGAGGTAGTTATCCTTAAAAACTCGAG
TTTTTAAGGATAACTACCTTTTTT, No.2:
CCGGCCTGAGACAGATCAGCAACAACTCGAGTTGTTGCTGATCTGTCTCAGGTTTTT)
were ligated into the pLKO-Tet-On vector (#21915, Addgene). To generate
lentiviral particles, 293T cells were transfected with a lentiviral plasmid,
packaging plasmid (pCMV-dR8.2), and envelope plasmid (pCMV-VSV-G) with FuGene
(Promega). Cells were infected with lentivirus in the presence of polybrene (8
μg/ml) for 8 hours. Three days later, cells were selected with puromycin
(0.6 μg/ml for LN229, U251, U87; 0.2 μg/ml for Gli36, MGG4, MGG75,
and MGG152) for 3–4 days before use. To induce expression of Myc shRNA,
infected cells were cultured with Doxycycline (1 μg/ml) for at least 72
hours. Knockdown and overexpression was confirmed by western blot.

293T cells were co-transfected with lentivirus vectors containing MYC (pCDH-puro-cMYC, Plasmid #46970, Addgene) or GFP (pCDH-CMV-MCS-EF1-copGFP, CD511B-1, System Bioscience), pCMV-dR8.2 dvpr, and pCMV-VSVG with ScreenFect (Wako). U87 cells were infected with lentivirus with polybrene (8 µg/ml) for 6 hrs, and then selected with puromycin (0.7 µg/ml) for 7 days, then maintained in puromycin (0.2 µg/ml).