The PCR primers used for real-time PCR quantification of total bacteria, fungi, protozoa, methanogen, Clostridium sticklandii, and Clostridium aminophilum are listed in Supplementary Table S1 . Among these microbial groups, C. aminophilum and C. sticklandii are two of the main hyper-ammonia-producing bacteria (HAB ) isolated from the rumen contributing to elevated deamination therein (Russell et al., 1988 (link)). Plasmid DNA containing each cloned respective target sequence was obtained by PCR and cloning (Koike et al., 2007 (link)), and the resultant recombinant plasmids were used as the standard DNA in real-time PCR. Real-time PCR was performed on a StepOnePlus platform (Applied Biosystems, Foster City, CA, United States) using SYBR Premix Ex Taq dye (Takara). Quantification of copies of 16S rRNA gene (total bacteria, C. sticklandii and C. aminophilum), 18S rRNA gene (fungi and protozoa), and methyl coenzyme-M reductase gene (mcrA, for methanogens) in each sample was performed in triplicate, and the mean value was calculated. Standard curves were generated using 10-fold serial dilutions of each standard DNA containing the target gene sequences of the respective microbial group. The absolute abundance of each microbial population was expressed as copies of the target gene/mL of culture samples.
Sybr premix ex taq dye
Manufactured by Takara Bio
Sourced in United States
SYBR Premix Ex Taq dye is a ready-to-use solution for real-time PCR amplification. It contains SYBR Green I dye, Taq DNA polymerase, dNTPs, and buffer components.
Automatically generated - may contain errors
Lab products found in correlation
Steponeplus platform, by Thermo Fisher Scientific (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Revertra ace, by Toyobo (2 mentions)
Steponeplus system, by Thermo Fisher Scientific (2 mentions)
Abi 7300 real time pcr system, by Thermo Fisher Scientific (2 mentions)
Rox reference dye, by Takara Bio (2 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (2 mentions)
Primerscript rt reagent kit, by Takara Bio (1 mentions)
Real time pcr system, by Takara Bio (1 mentions)
Sybr premix ex taqtm, by Takara Bio (1 mentions)
Sybr premix ex taq, by Takara Bio (1 mentions)
Primescript rt reagent kit with gdna eraser, by Takara Bio (1 mentions)
Lightcycler 480 system, by Roche (1 mentions)
Cfx96 pcr system, by Bio-Rad (1 mentions)
10 protocols using sybr premix ex taq dye
1
Quantification of Rumen Microbiome
2
Real-time qPCR Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time quantitative PCR (qPCR) was performed to check mRNA expression levels of the tested genes. Total RNA was extracted with Trizol (Invitrogen) and complementary DNAs were synthesized with high-efficiency reverse transcriptase Revertra Ace (Toyobo). A Biorad CFX96 PCR system was employed to perform real-time PCR using SYBR Premix Ex Taq dye (Takara). The primer sequences were as follows: for β-actin, 5′-ATGGATGATGAAATTGCCGCAC-3′ (forward) and 5′-ACCATCACCAGAGTCCATCACG-3′ (reverse); for gsc, 5′-GAGACGACACCGAACCATTT-3′ (forward) and 5′-CCTCTGACGACGACCTTTTC-3′ (reverse); for chd, 5′-TAGACTGCTGTAAGGAGTGTCCTC-3′ (forward) and 5′-CCATGAAGTCCTCTATGCATTCCG-3′ (reverse); for eve1, 5′-GCGAACTGGCGGCAGCCCTTAACT-3′ (forward) and 5′-GTAGGTCGATGGAGGCAGGTGCAAAG-3′ (reverse); for vent, 5′-GCAAGTTCTCAGTGGAGTGGCT-3′ (forward) and 5′-TCTGATCGCAGGTGAATTTGGT-3′ (reverse); for pinhead, 5′-AGTCCAGTGAATGTAGATG-3′ (forward) and 5′-CTCTCGCAGACCTTCATACAG-3′ (reverse); for admp, 5′-TCATGTTGTATGCAATGTTC-3′ (forward) and 5′-GTGACTCCGTCGACATCAGC-3′ (reverse); for gfp, 5′-TGAAGTTCATCTGCACCACCGGCAA-3′ (forward) and 5′-CCAGGATGTTGCCGTCCTCCTTGAA-3′ (reverse).
3
Intestinal Barrier Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the jejunum using an RNAeasy kit (Aidlab Bio CO.Ltd, Beijing, China) following the manufacturer's protocols. PrimerScript TM RT Reagent kit (TaKaRa, Japan) was used to convert RNA to cDNA. QPCR assays were performed on the Step One Plus real-time PCR System using SYBR Premix Ex Taq dye (TaKaRa, Japan). Primer sequences are listed: claudin-1 (F: GAGGATGGTCACACCGTGGT, R: GGAGGATGCTGTTGTCTCGG), occludin (F: ATGCTTTCTCAGCCAGCGTA, R: AAGGTTCCATAGCCTCGGTC), ZO-1 (zonula occludens 1) (F: ACAGGAGGGAAGCCATTTTCA, R: ATTTAAGGACCGCCCTCTCC), β-actin (F: AGAGCGCAAGTACTCCGTGT, R: ACATCTGCTGGAAGGTGGAC).
4
Quantifying Microbial Populations in Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The PCR primers used for real-time qPCR of total bacteria [34 (link)], fungi [34 (link)], protozoa [35 (link)], methanogens [36 (link)], and SRB [37 (link)] are listed in Table S1 . Real-time PCR was performed on a StepOnePlus system (Applied Biosystems, California, USA) using the SYBR Premix Ex Taq dye (Takara Bio Inc.). Copies of 16S rRNA gene (total bacteria), 18S rRNA gene (fungi and protozoa), methyl coenzyme-M reductase alpha subunit gene (mcrA, for methanogens), and dissimilatory sulfite reductase alpha subunit gene (dsrA, for SRB) in each sample was quantified in three technical replicate against respective standards, which were purified PCR products of known length and concentration. The absolute abundance of each microbial population was expressed as copies of the target gene/g of samples.
5
Quantitative PCR for Protozoal 18S rRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The quantitative PCR was performed on a ABI 7300 real-time PCR System (Life Technologies, CA, United States) using SYBR Premix Ex Taq dye (TaKaRa Biotechnology, Dalian, China). The protozoal 18S rRNA primer (Sylvester et al., 2004 (link)) reported in previous study was used for the quantitative PCR. Each 20 μl reaction mixture contained 10 μl SYBR Premix Ex TaqTM (TaKaRa Biotechnology, Dalian, China), 0.4 μl of each primer (10 μM), 0.4 μl ROX Reference Dye (TaKaRa Biotechnology, Dalian, China), 6.8 μl of nuclease-free water and 2 μl of the template. Copies of 18S rRNA gene was quantified in triplicate. A standard curve was prepared by using a 10-fold serial dilutions of purified plasmid DNA containing the 18S rRNA gene sequence. The total numbers of gene copies were expressed as log10 numbers of marker loci gene copies per gram of sample.
6
Rumen Microbial Quantification by qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The copy numbers of the total bacteria and protozoa from each rumen sample were measured by quantitative real-time PCR using specific 16S rRNA (Forward: GTGSTGCAYGGYYGTCGTCA, Reverse: ACGTCRTCCMCNCCTTCCTC) (Maeda et al., 2003 (link)) and 18s rRNA (Forward: GCTTTCCGWTGGTAGTGTATT, Reverse: CTTGCCCTCYAATCGTWCT) (Sylvester et al., 2004 (link)) primers, respectively. A real-time PCR was performed on the StepOnePlus platform (Applied Biosystems, Foster City, CA, United States) using SYBR Premix Ex Taq dye (Takara, Beijing, China). The PCR was performed in a two-step thermal cycling process that consisted of hot start activation at 95 °C for 30 s, which was followed by 40 cycles at 95 °C for 5 s, and 60 °C for 1 min (Ren et al., 2020 (link)). Quantification of the copies of total bacteria and protozoa in each sample was performed in triplicate, and the mean value was calculated. Standard curves were generated using the 10-fold serial dilutions of each standard DNA containing the target gene sequences of the respective microbial group. The absolute abundance of each microbial population was expressed as the log10 gene copies per ng DNA.
7
Quantifying Bacterial 16S rRNA Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The bacterial 16S rRNA gene copy number was determined by quantitative PCR on a ABI 7300 real‐time PCR System (Life Technologies) suing SYBR Premix Ex Taq dye (TaKaRa Biotechnology). The primers reported in previous study were used for the quantitative PCR (Maeda et al., 2003 ). Each 20 µl reaction mixture contained 10 µl SYBR Premix Ex Taq™ (TaKaRa Biotechnology), 0.4 µl of each primer (10 µM), 0.4 µl ROX Reference Dye (TaKaRa Biotechnology), 6.8 µl of nuclease‐free water, and 2 μl of the template. The PCR was performed in a two‐step thermal cycling process that consisted of hot start activation at 95°C for 30 s, followed by 40 cycles at 95°C for 5 s, and 60°C for 1 min. The quantification of bacterial 16S rRNA gene copies in each sample was performed in triplicate, and the mean value was calculated. A standard curve was prepared by using a 10‐fold serial dilution of purified plasmid DNA containing the 16S rRNA gene sequence. The total number of gene copies was expressed as log10 numbers of marker loci gene copies per ng DNA.
8
Quantifying PEDV S gene mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To evaluate S gene mRNA expression on the cell surface, ST cells in the six-well plates were infected with PRVΔTK&gE−AH02 or recombinant PRVs expressing S gene of PEDV at a multiplicity of infection (MOI) of 10. At 6 and 12 h post infection, infected-cells were separately harvested. Total RNA of infected-cells was extracted using TRIzol reagent [21 (link)]. A total of 1 µg total RNA from different treatments was reverse transcribed using a PrimeScript® RT Reagent Kit with gDNA Eraser (Takara Bio). RT-PCR with a pair of primers for S gene (S exp F/R, Table 1 ) was carried out on Roche Light Cycler® 480 system (Roche Diagnostics, Burgess Hill, UK) using SYBR Premix Ex Taq dye (Takara) [22 ]. Each cDNA was analyzed in triplicate, and sample data were normalized to Beta actin expression using the 2−ΔΔCt method.
9
Rumen Microbiome DNA Quantification Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Microbial genomic DNA of the rumen culture samples was extracted using the bead-beating and phenol-chloroform extraction method (25 (link)). The DNA integrity was examined using agarose (1.2%) gel electrophoresis, and the DNA quantity of each sample was determined using a Nanodrop 2000 (Thermo Fisher Scientific, Inc., Madison, USA).
The PCR primers used for real-time quantitative PCR (qPCR) of total bacteria (25 (link)), fungi (26 (link)), protozoa (27 (link)), and methanogens (28 (link)) are listed inSupplementary Table 1 . Real-time qPCR was performed on a StepOnePlus system (Applied Biosystems, California, USA) using the SYBR Premix Ex Taq dye (Takara Bio Inc.). Copies of 16S rRNA gene (total bacteria), methyl coenzyme-M reductase alpha-subunit gene (mcrA, methanogens), and 18S rRNA gene (fungi and protozoa) in each sample were performed in triplicate. Standard curves were generated using 10-fold serial dilutions of purified plasmid DNA containing the target gene sequences of each microbial group. The absolute abundance of each microbial population was expressed as copies of the target gene/mL of each sample.
The PCR primers used for real-time quantitative PCR (qPCR) of total bacteria (25 (link)), fungi (26 (link)), protozoa (27 (link)), and methanogens (28 (link)) are listed in
10
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with Trizol (Invitrogen) and complementary DNA was synthesized with high-efficiency reverse transcriptase Revertra Ace (Toyobo). A Biorad CFX96 PCR system was employed to perform qRT–PCR using SYBR Premix Ex Taq dye (Takara). The information of primer sequences were given in Supplementary Table 1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!