Q solution

PCRs were performed on genomic DNA to confirm the maf3 locus sequence. PCR was performed in 15-µl reaction mixtures containing 0.5-ng genomic DNA, 5 µl of 5× Q solution (Qiagen), 1.5 μl 10× reaction buffer (Qiagen), 0.3 µl 25 mM MgCl₂, 0.3 µl 10 mM deoxynucleoside triphosphates (dNTPs) (Sigma), 0.12 µl TopTaq polymerase (Qiagen), and 5 µM of each primer (NMA2112F, 5′ TCCAGCTTACGGAAAAAGAATCC 3′; NMA2112R, GGAAAACCTATGGGATGATACGG 3′). PCR conditions were 94°C for 2 min, 30 cycles of 94°C for 20 s, 53°C for 45 s, and 72°C for 3 min, and finally 72°C for 10 min. PCR products were sequenced using the primers used for PCR amplification and additional sequencing primers (SeqNMA2112F, 5′ GGACATCGTGATTGGAATCG 3′; SeqNMA2112R, 5′ AAAGCATTCGGATTTTCAGG 3′; SeqNMA2112, 5′ CCAAAACAGCCTACGTCTTGC 3′).

The genomic DNA for each EOC cell line (OV90, TOV21G, TOV112D, TOV81D, TOV1946, OV1946 and TOV2223) was amplified for each of the five exons of IGFBP7 and flanking introns using previously published primer sets [54 (link)] (Additional file 1). PCR reactions were performed as described above, but using the following PCR thermal cycler conditions for each primer set: 95°C for 3 minutes, 94°C for 30 seconds, 60°C for 30 seconds, 72°C for 30 seconds, and a final extension at 72°C for 5 minutes for 35 cycles. QIAGEN HotStart Taq Plus DNA Polymerase and 5X Q-solution (Cat. No. 203603, QIAGEN Inc. Mississauga, ON, Canada) were used for the amplification of the G-C rich exon 1. PCR products were then subjected to a Sanger sequencing protocol using 3730XL DNA Analyzer systems from Applied Biosystems at the McGill University and Genome Québec Innovation Centre (gqinnovationcenter.com). Sequencing chromatograms were analysed using 4Peaks Version 1.7.2. Sequence alignment was performed using the ClustalW multiple sequence alignment platform from the European Bioinformatics Institute [55 (link)] and compared with NM_001553 (IGFBP7) sequence. Variants identified were compared with those reported in the Single Nucleotide Polymorphism (dbSNP) database (http://www.ncbi.nlm.nih.gov/projects/SNP/).

The PCR reactions were carried out in a Bio-Rad C1000 Touch © Thermal Cycler (Bio-Rad, Hercules, California USA). Initial PCR’s were performed using four different volumes of target DNA and PCR grade water: 1, 2, 2.5 and 3.5 μL of target DNA and 3.65, 2.65, 2.15 and 1.15 μL of PCR grade water, respectively. The best quality of bands and detection was achieved with 3.5 μL of target DNA. Hence, the PCR components were optimized as follows: 6.25 μL of 2x Qiagen Multiplex Master Mix (Qiagen, Hilden, Germany), 0.1 μL of 5xQ-solution (Qiagen, Hilden, Germany), 0.25 μL of Bovine Serum Albumin (Thermo Scientific, Waltham, MA USA), 1.15 μL of PCR grade water, 1.25 μL of primer mix, and 3.5 μL of DNA, to the total volume of 12.5 μL. The PCR reaction cycle started with an initial denaturation at 95°C for 15 min, followed by 34 cycles of 30 s denaturation at 95°C, 90 s annealing at 60.0°C, 90 s of extension at 72°C and a final extension at 72°C for up to 10 min. The PCR products were visualized using QIAxcel Advanced Systems (Qiagen®).
Primer mixes were created and tested based on the primers target product size, compatibility, sensitivity and specificity towards their target DNA. Step-wise testing was performed to adjust the concentration of primers within each mix to ensure standardized sensitivity of all primer pairs for their target plant DNA.

Sanger sequencing of the cDNA of MB21D2 and LEPREL1 was performed in one LS-affected Lundehund and one Great Dane as control dog. RNA was obtained from hair roots in stabilized RNALater reagent (Quiagen, Maryland, USA), transcribed into cDNA and used for PCR amplification according to a standardized protocol [54 (link)] (Additional file 13). Alignment and variant detection was performed using the analysis software Sequencher 4.8 (Genes Codes, Ann Arbor, MI, USA). Despite the use of Q-solution (Quiagen) as enhancer reagent and Gradient PCR for optimizing reaction conditions, the coding region of FGF12 could not be amplified from these hair root samples at all.

The presence of the expanded hexanucleotide repeat and the number repeats for the longest allele was determined by previously reported methods for both a modified repeat-primed PCR and a fluorescence-based fragment size analysis as previously reported [80 (link),101 ,102 ]. Briefly, repeat-primed PCR was performed containing 100 ng genomic DNA, 1x FastStart PCR Master Mix (Roche Applied Science, Indianapolis, IN, USA), 3.5% DMSO, 1x Q solution (Quiagen, Valencia, CA) and 0.18 mM of deazaGTP (NEB, Ipswich, MA). PCR products were run on a Genetic Analyzer 3500 (Applied Biosystems) and analyzed using GeneMapper. A sample was considered positive for a repeat expansion when assay replicates demonstrated >30 peaks and a decrementing saw-tooth pattern with 6 bp periodicity.

Genomic DNA for GAA expansion analyses was extracted from fibroblasts and iPSCs using the QIAamp DNA Mini Kit (Qiagen) according to the manufacturer's instructions. The concentration and purity of the genomic DNA were assessed using a Nanodrop1000 spectrophotometer (Thermo Fisher Scientific). The size of the GAA expansion in intron 1 of the FXN gene was determined by PCR using the Expand Long Range dNTPack (Roche, Australia) as recommended with 20 ng template DNA, 0.4 μM of EXP-Bam-F 5′AAGGAAGTGGTAGAGGGTGTTTCACGAGGA3′ and EXP-Bam-R 5′TTTGGATCCAACTCTGCTGACAACCCATGCTGTCCACA3′ primers and 1x Q solution (QIAGEN, Australia). PCR products were electrophoresed on a 1% (w/v) agarose, 1x TAE gel alongside standard DNA markers (200 bp ladder, Promega). Size determination was performed using GeneTools software from SynGene, Synoptics (In Vitro Technologies). The positive control (BAC clone RP11-265B8) and non-expanded alleles in the normal range yielded an 810 bp fragment. The hESC H9, BG01V (ATCC) and the human fibroblast feeders WS1 (ATCC) were included as negative controls for FXN expansion.