Tamoxifen

Experiments were conducted on the MCF7 human breast cancer cell line (18 (link)) (cat. no. HTB-22^™; American Type Culture Collection), authenticated by morphology and STR profiling through ‘Gordiz’ (http://gordiz.ru/, accessed on February 1, 2022). The cells were cultured at 37˚C with 5% CO₂ in DMEM containing 4.5 g/l glucose (cat. no. СC420-02; PanEco), alanyl-glutamine (cat. no. Ф005; PanEco) and 7% fetal bovine serum (FBS) (cat. no. SV30160.03; HyClone; Cytiva). The response of the cells to tamoxifen (cat. no. 27190; Cayman Chemical Company) was assessed by treating them with tamoxifen for 3 days, followed by evaluating viability using the MTT assay [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] (cat. no. A2231; PanReac AppliChem) (19 (link)) modified as previously described (20 ). Dimethyl sulfoxide (DMSO) (cat. no. 191954; PanReac AppliChem) served as the solvent for the assay. Ultrapure water for the experiments was prepared using a Milli-Q water purification system (Merck KGaA).

Tamoxifen (Cayman Chemicals, Cambridge Biosciences, Cambridge, UK) was prepared as previously described in ethanol and corn oil.^{8 (link)} Groups of at least 5 female mice aged 10–12 weeks were administered either 150 mg/kg Tamoxifen or vehicle via a single intraperitoneal injection. Seventy-two hours later, animals were killed by cervical dislocation, and gastric tissues were harvested for histology.
Whole-body γ-irradiation was performed by exposure to a Caesium-137 source in a GammaCell closed source irradiator. Groups of at least 6 female mice aged 10–12 weeks were exposed to a single 12 Gy fraction of γ-irradiation. Animals were returned to standard housing conditions prior to being killed at 6 or 48 h after procedure by cervical dislocation. Gastric tissues were harvested for histology. In a separate experiment, similar groups of three mice were treated identically prior to cervical dislocation at 6 h. From these animals, the luminal surface of the stomach was scraped to generate gastric mucosa-enriched samples and flash-frozen in liquid nitrogen prior to nucleic acid extraction.

To generate inducible cardiomyocyte-specific MITOL knockout animals, mice bearing MITOL floxed alleles (MITOL^Flox/FLox) were crossed with transgenic mice expressing MerCreMer under the control of the cardiac α-myosin heavy chain (αMHC) (Sohal et al., 2001 (link)). Tamoxifen-induced Cre LoxP recombination was activated by intraperitoneal administration of Tamoxifen (#13258, Cayman Chemical) for 5 days. Cre-negative littermates, also receiving Tamoxifen treatment, were used as controls. All animals were maintained under university guidelines for the care and use of animals. The experiments were performed after securing Tokyo University of Pharmacy and Life Sciences Animal Use Committee Protocol approval. PCR genotyping was performed with the following primers:
MITOL Fw: CACAGGTACGGTAGGTGTGTAAGC
MITOL Rv: ATGGGAATGTGGTTCAGTTGTACC
Cre Fw: GTTTCACTGGTTATGCGGCGG
Cre Rv: TTCCAGGGCGCGAGTTGATAG

Lats1^fl/fl mice (024941, The Jackson Laboratory), Lats2^fl/fl mice^{48 (link)} and Rosa26-LSL-tdTomato mice (007914, The Jackson Laboratory), Lep^ob/+ mice (000632, The Jackson Laboratory), Yap^fl/fl mice^{49 (link)}, Taz^fl/fl mice^{50 (link)}, Adipoq-Cre (010803, The Jackson Laboratory) and Adipoq-CreER^T2 transgenic mice (024671, The Jackson Laboratory) were bred to generate mice used in this study. Tamoxifen (13258, Cayman Chemical) was dissolved in corn oil (C8267, Sigma) and administered via intraperitoneal injection to mice every other day for three doses of 100 mg per kg body weight Tamoxifen to induce CreER^T2 activity. Littermates with control genotypes served as the control group. Male mice were used in all studies except for experiments in Figs. 2c,d and 6e, and Fig. 5, which included both male and female mice. All mice were housed in a specific pathogen-free facility within the Korea Advanced Institute of Science and Technology Laboratory Animal Resource Center. Mice were maintained under a 12-h light–dark cycle and given free access to chow diet (2018, Teklad), chow diet containing 5 mg per kg body weight rosiglitazone (122320-73-4, Adooq Bioscience) or diet containing 60 kcal% fat (D12492, Research Diets) and water. All protocols for mouse experiments were approved by the Institutional Animal Care and Use Committee of the Korea Advanced Institute of Science and Technology.

Pax7^CreERt2/+Rosa26^Pham/+ mice (Pham et al., 2012 (link)) were given five 2 mg doses (10 mg total) of tamoxifen (Cayman Chemical, 13258) (TAM) by intraperitoneal injection prior to injury. Barium chloride (25 μl 1.2% in sterile demineralized water) was injected into the tibialis anterior muscle of each mouse with a Hamilton syringe similar to Murphy et al., 2014 (link).