Stepone system

Manufactured by Thermo Fisher Scientific

Sourced in United States, Japan, China, Germany, Netherlands, United Kingdom, France

The StepOne system is a real-time PCR instrument designed for gene expression analysis and quantification. It features a compact design and intuitive software interface, enabling efficient data collection and analysis.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

StepOne (326 citations) Applied Biosystems StepOne Plus Real-Time PCR Systems (5 citations) ABI RT-PCR StepOne Plus System (5 citations) StepOne and QuantStudio 5 Real-Time PCR systems (2 citations) StepOne™ Real-Time PCR Systems and Software (v2.3) (2 citations) StepOne Real-Time PCR systems software v2.1 (2 citations) StepOne™ (48-well) Real-Time PCR Systems (2 citations) StepOne/StepOne Plus real-time PCR systems (2 citations) StepOne/QuantStudio 6 Flex Real Time PCR Systems (2 citations) StepOne Plus Real-Time PCR system 2.2.3 (2 citations)

296 protocols using stepone system

Quantifying Differentially Expressed RNAs in Preterm Exosomes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Based on relatively high abundance, FC ≥ 2.5, P < 0.01, and their host genes, we selected six differentially expressed RNAs to validate their expression in umbilical cord blood exosomes from additional ten BPD and ten NBPD preterm infants by quantitative real-time polymerase chain reaction (qRT-PCR) analysis, including three circRNAs (hsa_circ_0086913, hsa_circ_0007372 and hsa_circ_0065188) and three lncRNAs (membrane associated guanylate kinase, WW and PDZ domain-containing 2 (MAGI2) antisense RNA 3 (MAGI2-AS3), brain abundant membrane attached signal protein 1 antisense 1 RNA (BASP1-AS1), and solute carrier family 2 member 1 antisense RNA 1 (SLC2A1-AS1)).
After extracting total RNA from LPS-induced BEAS-2B cells and HUVECs, cDNA was prepared with RNA using an RNeasy plus micro kit, as the starting material of qPCR, carried out using a Step One System (Life Technologies Corp). Subsequently, four differentially expressed circRNAs (hsa_circ_0086913, hsa_circ_0049170, hsa_circ_0087059, and hsa_circ_0065188) and two lncRNAs (small nucleolar RNA host gene 20 (SNHG20) and LINC00582) selected based on the P value and fold change were evaluated by qRT-PCR analysis.
Primer Premier software 4.0 (Premier, Canada) was used to design sequences of all primers (see Table S1). GAPDH was normalized using the 2^−ΔΔCTapproach.

Wang Y., Wang X., Xu Q., Yin J., Wang H, & Zhang L. (2022). CircRNA, lncRNA, and mRNA profiles of umbilical cord blood exosomes from preterm newborns showing bronchopulmonary dysplasia. European Journal of Pediatrics, 181(9), 3345-3365.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Adipogenic Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from cells using RNAzol RT Reagent (Molecular Research Center, Cincinnati, OH), and cDNA was synthesized from the total RNA using a ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO, Osaka, Japan). The procedures were performed according to the respective manufacturer’s protocols. The qPCR reactions were conducted in an Applied Biosystems StepOne system (Life Technologies) with KAPA SYBR FAST qPCR Kit Master Mix (2X) ABI Prism (KAPA Biosystems, Boston, MA). All samples were analyzed in triplicate and quantified by the relative standard curve method using the gene expressions of Rplp0 as an internal control. The sequences of the primer pairs used in this study are listed in Table 1.Table 1

Oligodeoxynucleotide primers used in the RT-qPCR experiments

Gene	Forward (5′-3′)	Reverse (5′-3′)
Rplp0	AGATTCGGGATATGCTGTTGGC	TCGGGTCCTAGACCAGTGTTC
Cebpa	CAAGAACAGCAACGAGTACCG	GTCACTGGTCAACTCCAGCAC
Pparg	TCGCTGATGCACTGCCTATG	GAGAGGTCCACAGAGCTGATT
Slc2a4	GTGACTGGAACACTGGTCCTA	CCAGCCACGTTGCATTGTAG
Fasn	GGAGGTGGTGATAGCCGGTAT	TGGGTAATCCATAGAGCCCAG
Adipoq	TGTTCCTCTTAATCCTGCCCA	CCAACCTGCACAAGTTCCCTT
Cebpb	AAGCTGAGCGACGAGTACAAGA	GTCAGCTCCAGCACCTTGTG
Cebpd	TTCAGCGCCTACATTGACTC	GCTTTGTGGTTGCTGTTGAAG
Cidea	ATCACAACTGGCCTGGTTACG	TACTACCCGGTGTCCATTTCT
Pgc1a	CATTTGATGCACTGACAGATGGA	GTCAGGCATGGAGGAAGGAC
Prdm16	GACATTCCAATCCCACCAGA	CACCTCTGTATCCGTCAGCA

Ando Y., Sato F., Fukunaga H., Iwasaki Y., Chiba Y., Tebakari M., Daigo Y., Kawashima J, & Kamei J. (2019). Placental extract suppresses differentiation of 3T3-L1 preadipocytes to mature adipocytes via accelerated activation of p38 MAPK during the early phase of adipogenesis. Nutrition & Metabolism, 16, 32.

+ Open protocol

+ Expand

Quantitative Analysis of Cdnk1a and Notch1 in Thymocytes

Check if the same lab product or an alternative is used in the 5 most similar protocols

For Cdnk1a gene expression analysis, DN thymocytes from wt and Heb/Tcf12^-/- newborn mice were sorted by flow cytometry and cDNAs were prepared as described previously (39 (link)). Southern blots of the amplicons were revealed by hybridization using an internal ³²P-labeled oligonucleotide fragment (primer sequences are listed in Supplementary Table l). The ribosomal Rps16 expression was used as a control for cDNA quality and quantity.
For Notch1 sequencing, cDNA was prepared from total RNAs as described previously (39 (link)). Amplification of Notch1 exons 26, 27, and 34 from leukemias cDNA were Sanger sequenced in both directions. Quantitative gene expression analysis was performed on StepOne system (Life Technologies) using specific primers and Advanced qPCR mix (Wisent). Primer sequences used for specific mRNA amplification are listed in Supplemental Table S1.

Veiga D.F., Tremblay M., Gerby B., Herblot S., Haman A., Gendron P., Lemieux S., Zúñiga-Pflücker J.C., Hébert J., Cohen J.P, & Hoang T. (2022). Monoallelic Heb/Tcf12 Deletion Reduces the Requirement for NOTCH1 Hyperactivation in T-Cell Acute Lymphoblastic Leukemia. Frontiers in Immunology, 13, 867443.

+ Open protocol

+ Expand

Quantifying Gene Expression Levels

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total cellular RNA was extracted from A549 and SPC-A1 cells after transfecting with targeted gene interfering sequences (pLenti-shRNA-AATi or pLenti-shRNA-FNi) or coding sequence of AAT, respectively, using TRIzol (Invitrogen, Waltham, MA, USA). Subsequently, real-time RT-PCR was performed to determine AAT and FN expression in the StepOne System (Life Technologies, Carlsbad, CA, USA). RNA was also extracted from HUVEC after transfecting with targeted gene interfering sequences (pLenti-shRNA-ITGA5i or pLenti-shRNA-DDP IVi) and real-time RT-PCR was performed to determine integrin α5 and DPP IV expression, respectively. Relative gene expression was determined by the ΔΔCt method (ΔΔCq) based on glyceraldehyde-3-phosphate dehydrogenase (GAPDH) levels (18 (link)), and results were expressed as fold change over different conditions.

Li Y., Miao L., Yu M., Shi M., Wang Y., Yang J., Xiao Y, & Cai H. (2017). α1-antitrypsin promotes lung adenocarcinoma metastasis through upregulating fibronectin expression. International Journal of Oncology, 50(6), 1955-1964.

+ Open protocol

+ Expand

Quantitative PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Complementary DNAs were reverse transcribed from RNAs extracted in TRIzol from cell cultures and isolated hearts using the Quanti-Tect kit (Qiagen) and Superscript II Reverse Transcriptase (Life Technologies) respectively. Quantitative PCR was carried out on a StepOne System (Life Technologies) using Fast Start SYBR Green Master (Roche). Quantification of gene expression was calculated as R=2^{ΔCt(control-target)}, with Gapdh used as a control. Primers were designed using the NCBI Primer-BLAST software. Primer sequences are listed in Supplementary Table 1.

Ragni C.V., Diguet N., Le Garrec J.F., Novotova M., Resende T.P., Pop S., Charon N., Guillemot L., Kitasato L., Badouel C., Dufour A., Olivo-Marin J.C., Trouvé A., McNeill H, & Meilhac S.M. (2017). Amotl1 mediates sequestration of the Hippo effector Yap1 downstream of Fat4 to restrict heart growth. Nature Communications, 8, 14582.

+ Open protocol

+ Expand

Genotyping of CACNA1C rs1006737

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was extracted from ethylenediaminetetraacetic acid (EDTA) anti-coagulated venous blood according to standard protocols. CACNA1C rs1006737 was genotyped on a StepOne system (life technologies; Darmstadt; Germany) using TaqMan®SNP Genotyping Assay C___2584015_10 (life technologies; Darmstadt; Germany) and the standard protocol for allelic discrimination. Accuracy was assessed by duplicating 15% of the original sample, and reproducibility was 100%. The genotype frequencies did not deviate from Hardy–Weinberg equilibrium (HWE; p = 0.06).

Nieratschker V., Brückmann C, & Plewnia C. (2015). CACNA1C risk variant affects facial emotion recognition in healthy individuals. Scientific Reports, 5, 17349.

+ Open protocol

+ Expand

Analyzing Esophageal Cancer Exosome Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

After extracting total RNA from esophageal cancer (EC) tumor tissues,
EC9706-derived exosomes, HUVECs transfected with corresponding plasmids and EC
cell lines including EC9706, KYSE150, and YES2 according to the manufacturer's
protocol. cDNA was prepared with the extracted total RNA by the RNeasy plus
micro kit through reverse transcription in line with specific instructions, as
the starting material of real-time quantitative polymerase chain reaction
(RT-qPCR) carried out using Step One System (Life Technologies Corp).
2^−ΔΔCT approach normalized U6 and GAPDH. Primers used in this
research are displayed in Table 1.

Ding N., Song X., Yu H., Wang J., Huang L., Zhou Y, & He X. (2023). Mechanism of Exosomal LncRNA PART1 in Esophageal Cancer Angiogenesis by Targeting miR-302a-3p/CDC25A Axis. Technology in Cancer Research & Treatment, 22, 15330338231184327.

+ Open protocol

+ Expand

Quantifying Neuroinflammatory Markers in Brain Cortex

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total mRNA was extracted from the brain cortex using TRIzol reagent and reverse-transcribed into cDNA using the PrimeScript™ RT reagent kit (Takara, Japan), following the manufacturer’s instructions. RT-qPCR was performed using SYBR Green Real-time PCR Master Mix (Takara, Japan) with the Step One System (Life Technologies). The results were expressed as fold change from the untreated control and analyzed using the 2^−ΔΔCt method. The primers were as follows (5′–3′): MyD88 forward: TTTATCTGCTACTGCCCCAACG, reverse: GCGGCGACACCTTTTCTCA; TLR4 forward: ATGCTGCAACTGATGTTCCTTC, reverse: GATGTTAGACCTTTCTTCCTCCC; GAPDH forward: TGTTCCTACCCCCAATGTGTCC, reverse: GGAGTTGCTGTTGAAGTCGCAG; TNF-α forward: ATGGCCTCCCTCTCATCAGT, reverse: TGGTTTGCTACGACGTGGG; IL-6 forward: AGTGGCTAAGGACCAAGAC, reverse: ATAACGCACTAGGTTTGCCGA; iNOS forward: ATTCACAGCTCATCCGGTACG, reverse: GGATCTTGACCATCAGCTTGC; IL-1β forward: GCACTACAGGCTCCGAGATGAA, reverse: GTCGTTGCTTGGTTCTCCTTGT.

Li Z., Zhao M., Zhang X., Lu Y., Yang Y., Xie Y., Zou Z., Zhou L., Shang R., Zhang L., Jiang F., Du D, & Zhou P. (2022). TJ-M2010-5, a novel CNS drug candidate, attenuates acute cerebral ischemia-reperfusion injury through the MyD88/NF-κB and ERK pathway. Frontiers in Pharmacology, 13, 1080438.

+ Open protocol

+ Expand

Quantifying Hepatic HBV Transcripts and DNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Liver tissues were harvested, and HBV RNA and HBV DNA were isolated from mouse liver using the RNeasy 96 Kit and the DNeasy 96 Blood & Tissue Kit (Qiagen), respectively, per manufacturer's instructions. Real‐time polymerase chain reaction was performed with the StepOne System (Life Technologies). The primer and probe sequences for analysis of HBV expression were designed using Primer Express Software (PE Applied Biosystems, Waltham, Massachusetts) to detect full‐length, pre‐S1, and pre‐S2 HBV mRNAs (forward CCAAACCTTCGGACGGAAA; reverse TGAGGCCCACTCCCATAGG; probe CCCATCATCCTGGGCTTTCGGAAAATX). The amount of hepatic HBV DNA was normalized to the amount of total DNA determined by PicoGreen; serum HBV DNA was normalized to amount of DNA in a pool of saline day 0 samples. The amount of each HBV mRNA was normalized to amount of total RNA determined by RiboGreen.

Han K., Theodore D., McMullen G., Swayze E., McCaleb M., Billioud G., Wieland S., Hood S., Paff M., Bennett C.F, & Kwoh T.J. (2022). Preclinical and Phase 1 Assessment of Antisense Oligonucleotide Bepirovirsen in Hepatitis B Virus–Transgenic Mice and Healthy Human Volunteers: Support for Clinical Dose Selection and Evaluation of Safety, Tolerability, and Pharmacokinetics of Single and Multiple Doses. Clinical Pharmacology in Drug Development, 11(10), 1191-1202.

+ Open protocol

+ Expand

ATAC-Seq of Murine NK Cell Subsets

Check if the same lab product or an alternative is used in the 5 most similar protocols

ATAC-Seq was performed as described (31 ). Briefly, 50,000 BM CD27⁺CD11b⁻ NK cells from RId2^−/− and Ctrl mice and CD27⁻CD11b⁺ NK cells from Ctrl mice were sorted and used for each ATAC-Seq assay (2 assays). Nuclei were isolated lysing the cells with cold lysis buffer (10 mM Tris-HCl, pH 7.4, 10 mM NaCl, 3 mM MgCl₂ and 0.1% IGEPAL CA-630) followed by centrifugation at 500g for 10 min at 4 °C. The supernatant was carefully removed and the pellet was resuspended in transposase reaction mix (25 μl 2× Tagment buffer, 2.5 μl Tagment DNA enzyme (Illumina, FC-121–1030) and 22.5 μl nuclease-free water) and incubated at 37 °C for 30 min. After transposition, the sample was purified with a Qiagen MinElute kit and library fragments were amplified using Nextera PCR Primers (IlluminaNextera Index kit) and NEBnext PCR master mix (New England BioLabs, 0541) for a total of 10–12 cycles followed by purification with a Qiagen PCR cleanup kit.
The amplified, adaptor-ligated libraries were size-selected with Life Technologies E-Gel SizeSelect gel system in the range of 150–650 bp and quantified with an Agilent Bioanalyzer and via qPCR using the KAPA Library Quantification Kit on the Life Technologies Step One System. Libraries were sequenced on an Illumina HiSeq2000 to generate 7.5× 10⁷ to 10 × 10⁷ 50-bp paired-end reads.

Zook E.C., Li Z.Y., Xu Y., de Pooter R.F., Verykokakis M., Beaulieu A., Lasorella A., Maienschein-Cline M., Sun J.C., Sigvardsson M, & Kee B.L. (2018). Transcription factor ID2 prevents E proteins from enforcing a naïve T lymphocyte gene program during NK cell development. Science immunology, 3(22), eaao2139.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!