Lysing matrix d tube

Mice were sacrificed 24 h post infection and lungs were weighed, transferred into a Lysing Matrix D tube (MP Bio) and BSS was applied in an amount of the 10-fold volume of the lung. Organs were shredded using the FastPrep FP 120 (Savant). To remove the cell debris the homogenates were centrifuged for 15 min at 2000 rpm and the supernatant collected. The determination of virus titer in homogenates was performed using the AVICEL^® plaque assay described above.

RNA was isolated from tissues using TRIzol reagent (Thermo Fisher Scientific) as per provided instructions, with an initial step of homogenizing the tissues in TRIzol reagent within a bead-containing Lysing Matrix D tube (MP Biomedicals) using the Precellys 24 homogeniser (Bertin Technologies). Complementary DNA (cDNA) was prepared from 2 μg of RNA with the Maxima First Strand cDNA Synthesis Kit (K1641, Thermo Fisher Scientific). qPCR was ran using the Maxima SYBR Green qPCR Master Mix (K0221, Thermo Fisher Scientific) with 10 ng of cDNA per reaction. Analysis was done with the 2^-ΔΔCt method (Livak and Schmittgen, 2001 (link)) using Eef2 as loading control. Primers used are provided in Supplementary file 9.

At indicated time points, mice were euthanized with 100% isoflurane. The whole lung or nasal turbinate was placed in a Lysing Matrix D tube (MP Biomedicals) with 1 mL PBS and homogenized using a table-top homogenizer at medium speed for 2 min. Tissue homogenates were cleared of debris by centrifugation (15 min, 3,100 g). To determine infectious influenza viral titers, plaque assay was performed by standard protocol using Madin-Darby canine kidney (MDCK) cells. Briefly, plaques were resolved by crystal violet staining 48 to 72 h after infection and rinsing with water for plaque visualization. For viral RNA analysis, 250 µL of the nasal turbinate or lung homogenates was added to 750 µL Trizol LS (Invitrogen), and RNA was extracted with the RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions. The extracted RNA was reverse transcribed into cDNA using the iScript cDNA synthesis kit (Bio-Rad). Influenza A/PR8 RNA levels were quantified with 100 ng cDNA inputs using the iTaq Universal SYBR Green Supermix (Bio-Rad) and the following primers (5′-3′): PR8 hemagglutinin (Forward: AGTGCCCAAAATACGTCAGG, Reverse: GGCAATGGCTCCAAATAGAC), PR8 nucleoprotein (Forward: AGAACATCTGACATGAGGAC, Reverse: GTCAAAGGAAGGCACGATC).

RNA from cells was extracted using RNeasy Plus Mini kit (74106, Qiagen) following manufacturers’ instructions. 30 μl of RNAse-free water was used for elution.
RNA from tissues was harvested by adding 1 ml of RNA Stat-60 reagent (Tel Test) to approximately 100 mg of frozen tissue placed in a Lysing Matrix D tube (MP Biomedicals). Samples were homogenised using a FastPrep homogeniser (MP Biomedicals) for 2 × 45 s at 5.5 m/s and centrifuged at 14,000 g for 5 min to pellet debris. The aqueous phase was transferred to a fresh tube containing 200 μl chloroform. Samples were mixed and centrifuged at 14,000 g, 4°C for 15 min. The clear upper phase containing RNA was removed and precipitated by mixing it with 500 μl isopropanol and incubating at room temperature for 10 min. Samples were centrifuged at 14,000 g, 4°C for 10 min and supernatants were discarded. RNA pellets were then washed with 70% ethanol, air-dried and re-suspended in 100 μl of RNAse-free water.
RNA concentration and purity were determined using Nanodrop ND-1000 spectrophotometer (Thermofisher Scientific). The absorbance was measured at 260 nm against RNAse-free water. A single A260 unit was assumed to be equal to 40 μg/mL of RNA. All RNA samples were stored at −80°C for subsequent processing.

Eight-week-old female C57BL/6 mice (four per group) were anesthetized by intra-peritoneal injection of 200 µl of ketamine/rompun. Equal amounts of a 2% rompun (Bayer; Germany) and a 10% ketamine (Sanofi; Germany) stock solution were mixed with PBS in a 1:10 ratio. Mice were infected intra-nasally with 1.5 × 10⁵ PFU (5 × MLD₅₀) of A/FPV/Bratislava/79 (H7N7) diluted in 50 µl of BSS (buffered salt solution) by inoculating 25 µl into each nostril one hour after application of anesthesia. The Institutional Animal Care and Use Committee of Tuebingen approved all animal studies. Mice were sacrificed 24 h post-infection (p.i.), after which the lungs were weighed, transferred into a Lysing Matrix D tube (MP Bio, Germany) and mixed with a 10-fold volume of BSS. Organs were shredded using the FastPrep FP 120 device (Savant, Germany). To remove the cell debris, the homogenates were centrifuged for 15 min at 2000 r.p.m. and the supernatant was collected. The virus titers of the homogenates were determined using the AVICEL® plaque assay^{28 (link),29 (link)}.