Log In Sign up
The largest database of trusted experimental protocols

Pyromark assay design software

Manufactured by Qiagen
Visit Supplier
Sourced in Germany, United States, United Kingdom

The PyroMark Assay Design software is a tool developed by Qiagen for designing pyrosequencing assays. It is used to create and optimize pyrosequencing assays for various applications, including gene expression analysis, DNA methylation studies, and SNP genotyping.

Automatically generated - may contain errors

Lab products found in correlation

Pyromark pcr kit, by Qiagen (27 mentions) Pyromark q24, by Qiagen (24 mentions) Pyromark q24 system, by Qiagen (10 mentions) Ez dna methylation gold kit, by Zymo Research (7 mentions) Pyromark 24 pyrosequencing system, by Qiagen (7 mentions) Epitect bisulfite kit, by Qiagen (6 mentions) Nanodrop nd 1000 spectrophotometer, by Thermo Fisher Scientific (6 mentions) Ez dna methylation kit, by Zymo Research (5 mentions) Pyromark gold q24 reagent, by Qiagen (4 mentions) Pyro q cpg software, by Qiagen (4 mentions) Ez dna methylation lightning kit, by Zymo Research (4 mentions) Pyrogold sqa reagent kit, by Qiagen (4 mentions) Pyromark cpg software, by Qiagen (3 mentions) Pyromark gold reagents, by Qiagen (3 mentions) Pyromark q96 md system, by Qiagen (3 mentions) Epitect bisulphite conversion kit, by Qiagen (3 mentions) Pyromark q48 advanced cpg reagent, by Qiagen (3 mentions) Pyromark q48 autoprep software, by Qiagen (3 mentions) Truemethyl oxbs module, by Tecan (3 mentions) Qubit ssdna assay, by Thermo Fisher Scientific (3 mentions)

Spelling variants of this product

PyroMark Assay Design Software 2.0 (96 citations) PyroMark Assay Design software version 2.0 (18 citations) PyroMark Assay Design Software v2.0 (16 citations) PyroMark Assay Design (14 citations) PyroMark Assay Design Software 1.0 (3 citations) PyroMark CpG Assay Design Software (3 citations) PyroMark Assay Design software version (3 citations) PyroMark Assay Design Software package (2 citations)

107 protocols using pyromark assay design software

1

Genotyping of OPRM1 Variant Using Pyrosequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols
Genomic DNA (gDNA) was extracted from whole blood collected into EDTA tubes using an in-house salting-out method49 (link) at the Genomics Research Centre, Queensland University of Technology, Brisbane. A NanoDrop™ ND-1000 spectrophotometer (ThermoFischer Scientific Inc., Waltham, MA, USA) was used to measure DNA concentration and purity before dilution to 15–20 ng/μL and storing as stock gDNA at 4 °C. Genotyping of OPRM1 (rs1799971, 118A>G N40D) was conducted via pyrosequencing with primers designed using Pyromark Assay Design software (QIAGEN): 5ʹ CACTGATGCCTTGGCGTAC, 5ʹ GGGCACAGGCTGTCTCTC (biotinylated) and sequencing primer 5ʹ CAACTTGTCCCACTTAGAT. Pyrosequencing was performed on a QSeq platform (BioMolecular Systems) using Pyromark Gold Q24 reagents (QIAGEN). Sequencing traces were analyzed with QSeq software, version 2.1.3 (BioMolecular Systems). All genotyping was conducted by investigators blinded to sample identity. Genotypes were assigned using all of the data from the study simultaneously and not in batches.
Haupt L.M., Haywood A., Sutherland H.G., Yu C., Albury C.L., Pharasi A., Zunk M., George R., Griffiths L.R., Good P, & Hardy J. (2024). The effects of OPRM1 118A>G on methadone response in pain management in advanced cancer at end of life. Scientific Reports, 14, 3411.
+ Open protocol
+ Expand
2

Pyrosequencing Methylation Analysis of Sperm DNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Primers were designed for genes of interest using PyroMark Assay Design software (Qiagen, United States) (Supplementary Table S1). Bisulfite conversion of 40 ng of spermatic DNA was prepared by EZ DNA Methylation-Gold kit (Zymo Research, United States). Twenty ng of bisulfite converted DNA were amplified for pyrosequencing using Pyromark Q24 kit (Qiagen, United States) and Pyromark Q24 Vacuum workstation (Qiagen, United States) according to the manufacturer’s instructions.
Chen H., Scott-Boyer M.P., Droit A., Robert C, & Belleannée C. (2022). Sperm Heterogeneity Accounts for Sperm DNA Methylation Variations Observed in the Caput Epididymis, Independently From DNMT/TET Activities. Frontiers in Cell and Developmental Biology, 10, 834519.
+ Open protocol
+ Expand
3

Bisulfite Pyrosequencing of Leptin Promoter Methylation

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
DNA samples (500 ng) were sodium bisulfite-modified using the EZ DNA methylation Kit (Zymo Research, Irvine, CA, USA), following the manufacturer’s protocols. For methylation detection, bisulfite pyrosequencing was employed. Primers (Integrated DNA Technologies, Inc, Coralville, IA) were designed using the PyroMark Assay Design software version 2.0.1.15 (Qiagen) in a region previously associated with leptin expression (Bouchard et al., 2010 (link); Melzner et al., 2002 (link); Yokomori, Tawata, & Onaya, 2002 (link)). The PyroMark PCR kit (Qiagen) and PCR primers (Table S1) were used to amplify a 383 base pair region in the leptin promoter; cycling conditions were 94 °C for 15 min followed by 50 cycles of 94 °C for 1 min, 56 °C for 1 min and 72 °C for 1 min with a final extension of 10 min at 72 °C. Pyrosequencing was performed in triplicate using the Pyromark MD (Qiagen) instrument with two forward assays covering a total of 23 CpG loci (Tables S1 and S2). Non-CpG cytosines within each read served as internal controls to verify bisulfite DNA modification efficiency (>95% in all samples) and each pyrosequencing run included a no template control; all samples were sequenced by the same operator. DNA methylation results were analyzed with the PyroMark CpG software, version 1.0.11 (Qiagen).
Daniels T.E., Sadovnikoff A., Ridout K.K., Lesseur C., Marsit C.J, & Tyrka A.R. (2020). Associations of Maternal Diet and Placenta Leptin Methylation. Molecular and cellular endocrinology, 505, 110739.
+ Open protocol
+ Expand
4

Pyrosequencing of MEG3 Locus

Check if the same lab product or an alternative is used in the 5 most similar protocols
Pyrosequencing was performed to technically validate BisPCR2 at the MEG3 locus. Forward and reverse primers designed with Qiagen® PyroMark Assay Design software were used for both methods, and for pyrosequencing the reverse primer was biotinylated. Pyrosequencing primer sequences were as follows: Forward: 5′-GGGGTGATAGTTTTTGGTTTATATT-3′, Reverse: 5′-CCATAACCAACACCCTATAAT-3′, Sequencing: 5′-TTTTTATATATTGTGTTTGAATTTA-3′. Bisulfite-converted genomic DNA from human islets, processed as described above, was amplified with the Qiagen® PyroMark PCR Kit (Cat. No. 978703) per the manufacturer’s protocol. The pyrosequencing reaction was carried out using Qiagen® PyroMark Gold Q96 CDT Reagents on the PyroMark Q96 MD (QIAGEN) according to the manufacturer’s instructions.
Bernstein D.L., Kameswaran V., Le Lay J.E., Sheaffer K.L, & Kaestner K.H. (2015). The BisPCR2 method for targeted bisulfite sequencing. Epigenetics & Chromatin, 8, 27.
+ Open protocol
+ Expand
5

Quantifying TERT Promoter Methylation in Thyroid Cancer

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Methylation density at the TERT promoter was quantified in MTCs, normal thyroid samples and MTC cell lines by Pyrosequencing. Genomic DNA (150 ng) was subjected to sodium bisulfate modification using the EpiTect Bisulfite Kit (Qiagen AB, Sweden) according to the recommendations of the manufacturer. Converted DNA was then used as template for PCR amplification at 58°C annealing temperature. A Pyrosequencing assay targeting eight CpGs in the TERT promoter (Figure 1) was designed using PyroMark Assay Design software version 2.0 (Qiagen). The assay included the following primers: 5′-GGGTTTGTGTTAAGGAGTTTAAGT-3′ (forward biotinylated); 5′-AAACCCAAAACTACCTCCA-3′ (reverse); and 5′-CCAAAACTACCTCCAAAT-3′ (sequencing). The PCR products were immobilized to streptavidin-coated Sepharose beads and were captured using a pump with filter. Pyrosequencing reactions were run in a PyroMark Q24 and the data were analysed with the PyroMark Q24 software (Qiagen AB, Sweden). For each sample, a methylation index (Met I) was calculated as the mean methylation level of all CpG dinucleotides covered [28 (link)]. The methylation status in MTCs was defined based on the comparison to the normal thyroid samples.
Wang N., Kjellin H., Sofiadis A., Fotouhi O., Juhlin C.C., Bäckdahl M., Zedenius J., Xu D., Lehtiö J, & Larsson C. (2016). Genetic and epigenetic background and protein expression profiles in relation to telomerase activation in medullary thyroid carcinoma. Oncotarget, 7(16), 21332-21346.
+ Open protocol
+ Expand
6

Targeted Bisulfite Pyrosequencing for DNA Methylation

Check if the same lab product or an alternative is used in the 5 most similar protocols
DNA extraction and sodium bisulfite treatment were performed in the same manner as above for WGBS sample processing. Bisulfite pyrosequencing primers were designed using PyroMark Assay Design software (Qiagen, Hilden, Germany) to target CpGs within DMRs from the male replication comparison. Bisulfite-converted DNA from each sample was amplified in triplicate for each primer set using the PyroMark PCR kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions, except using 50 ng of bisulfite-converted DNA and 40 PCR cycles. Each PCR product was checked with gel electrophoresis for specific amplification. Pyrosequencing was conducted using PyroMark Gold Q96 SQA Reagents (Qiagen, Hilden, Germany) with the PyroMark Q96 instrument (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. Mean percent methylation for each region was compared to diagnosis outcome using linear regression and compared to WGBS methylation using Pearson’s r.
Mordaunt C.E., Jianu J.M., Laufer B.I., Zhu Y., Hwang H., Dunaway K.W., Bakulski K.M., Feinberg J.I., Volk H.E., Lyall K., Croen L.A., Newschaffer C.J., Ozonoff S., Hertz-Picciotto I., Fallin M.D., Schmidt R.J, & LaSalle J.M. (2020). Cord blood DNA methylome in newborns later diagnosed with autism spectrum disorder reflects early dysregulation of neurodevelopmental and X-linked genes. Genome Medicine, 12, 88.
+ Open protocol
+ Expand
7

DNA Methylation Quantification Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Bisulfite‐treated genomic DNA was amplified using a set of primers designed with PyroMark Assay Design Software version 2.0.01.15 (QIAGEN GmbH, Table S4). The target region for sequencing began 10 nucleotides (nt) before and ended 26 nt after cg15126544. PCR product pyrosequencing and methylation quantification were performed with sequencing primers using the PyroMark 24 Pyrosequencing System, version 2.0.6 (QIAGEN GmbH), according to the manufacturer's instructions.
Tsuboi M., Kondo K., Masuda K., Tange S., Kajiura K., Kohmoto T., Takizawa H., Imoto I, & Tangoku A. (2019). Prognostic significance of GAD1 overexpression in patients with resected lung adenocarcinoma. Cancer Medicine, 8(9), 4189-4199.
+ Open protocol
+ Expand
8

Bisulfite Conversion and PCR Amplification

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Bisulfite-converted DNA was PCR-amplified using primers designed in the Pyromark Assay Design Software (Qiagen, Germantown, MD, USA), with details of the assay and quality control previously published [22 (link)]. PCR and sequencing primers are listed in Table S1.
Yang I.V., Zhang W., Davidson E.J., Fingerlin T.E., Kechris K, & Dabelea D. (2018). Epigenetic marks of in utero exposure to gestational diabetes and childhood adiposity outcomes: the EPOCH study. Diabetic medicine : a journal of the British Diabetic Association, 35(5), 612-620.
+ Open protocol
+ Expand
9

Methylation Analysis of ccRCC Tissues

Check if the same lab product or an alternative is used in the 5 most similar protocols
Genomic DNAs from the 19 ccRCC tissues were extracted with TaKaRa MiniBEST Universal Genomic DNA Extraction Kit Ver.5.0. DNA concentrations were measured with a NanoDrop2000 spectrophotometer (USA). The methylation levels of CpG sites were evaluated with pyrosequencing. PyroMark Assay Design software (Qiagen) was used to design specific sets of primers for CpG PCR amplification and sequencing. The cg08995609 forward primer: GAGGGTTTTAGTTGGGGGATGTTA, reverse primer: ACCTAAAACCAAAAACAAATAAACAACT, sequencing primer: GTTGGGGGATGTTAT. All manipulations of bisulfite conversions, PCRs and pyrosequencings were previously described33 (link). DNA methylation of RAB25 promoter was quantified by MassARRAY EpiTYPER assays (Sequenom, San Diego, CA, USA). Primers were designed using the software sequenom®EpiDesigner, RAB25 sequences of PCR primers used in the study, tag-forward: aggaagagagGTATTGTTGGGTTTTTGGAATTTGT; tag-reverse: cagtaatacgactcactatagggagaaggctATCTCAACCCCTAAAACCTCTACC. Procedures of methylation assessments and quality controls had been described previously49 (link).
Gu Y., Zou Y.M., Lei D., Huang Y., Li W., Mo Z, & Hu Y. (2017). Promoter DNA methylation analysis reveals a novel diagnostic CpG-based biomarker and RAB25 hypermethylation in clear cell renel cell carcinoma. Scientific Reports, 7, 14200.
+ Open protocol
+ Expand
10

Validating Methylation Differences in GDM

Check if the same lab product or an alternative is used in the 5 most similar protocols
We sought to validate a few selected DMPs with relatively larger methylation differences between GDM and control groups in the epigenome wide association analysis. The study subjects were an independent random sample of 47 pairs of GDM and controls from the Shanghai Birth Cohort. 4 DMPs (CpG sites) were chosen as the corresponding delta betas were in the top 30 DMPs and the corresponding genes have been related to glucose homeostasis (30 (link), 31 (link)). These CpG sites were annotated to WSC Domain Containing 2 (WSCD2), phosphodiesterase 1C (PDE1C), and protocadherin Beta 15 (PCDHB15). DNA was sodium-bisulfite treated (EZ DNA Methylation-Lighting) and PCR-amplified with primers designed by PyroMark Assay Design software (version 2.0; Qiagen). Pyrosequencing was performed using PyroMark Q48 (Qiagen, appendix –Methodology in the pyrosequencing study).
Wang W.J., Huang R., Zheng T., Du Q., Yang M.N., Xu Y.J., Liu X., Tao M.Y., He H., Fang F., Li F., Fan J.G., Zhang J., Briollais L., Ouyang F, & Luo Z.C. (2022). Genome-Wide Placental Gene Methylations in Gestational Diabetes Mellitus, Fetal Growth and Metabolic Health Biomarkers in Cord Blood. Frontiers in Endocrinology, 13, 875180.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!