Lenti crispr cas9v2 vector

For targeting murine Mrc2 and other candidate genes, the relevant oligos (Table S1) were cloned into the lenti-CRISPR/Cas9-v2 vector (Addgene, #52961) following the Zhang lab protocol 41 (link). The lentiviral plasmid, envelope plasmid (pMD2.G), and packaging plasmid (psPAX2) were co-transfected into 293FT cells with PEI to produce the lentiviruses. The culture medium was collected and filtered through a 0.45-µm filter at 72 h after transfection. The viral media were then 100× concentrated via PEG precipitation, resuspended with PBS, and harvested for infection. Target cells were infected with the enriched virus for 48 hours. Positive cells were selected for 5-7 days with puromycin (4 µg/mL and 8 µg/mL for B477 and G600 cells respectively) after infection.
For validation of target modification, genomic DNA was isolated from the single clones of targeted cell lines. Following PCR amplification of murine Mrc2 (Forward: tcttcctcatcttcagccag, and Reverse: agtaaggtcgagcacatagg), the PCR products were sequenced. Allele modifications were determined by using the control cell as a reference sequence.

For targeting of murine Arhgef11 gene, the oligos (F1 5′CACCGTCACCCCCAAAATGGGCCGC3′ and R1-5′ AAACGCGGCCCATTTTGGGGGTGAC 3′, F2-5′CACCGCACTCACCTGCGGCCCATTT3′ and R2-5′AAACAAATGGGCCGCAGGTGAGTGC3′) were cloned into the lenti-CRISPR/Cas9v2 vector (Addgene, #52961) following the Zhang lab protocol^{77 (link)}. For targeting of murine and hominine Plekha5/PLEKHA5 gene, the oligos (F-5′CACCGCAGAGTTCTCATTAGACCCG3′ and R-5′AAACCGGGTCTAATGAGAACTCTGC3′ for mouse, F-5′CACCGTCCGGTGACCACCGCCTCGC3′ and R-5′AAACGCGAGGCGGTGGTCACCGGAC3′ for human) were used. The lentiviral plasmid, envelope plasmid (pMD2.G), and packaging plasmid (psPAX2) were transfected together into 293FT cells with PEI to produce viruses. The culture medium was collected and filtered with a 0.45-μm filter at 72 h after transfection. The viral media was 100× concentrated via PEG precipitation, resuspended with PBS, and saved for infection. Target cells were infected with virus together with 8 μg/ml polybrene. Positive cells were selected for 7 days with puromycin 72 h after infection. All cells used for metastasis experiments were stably labeled with a GFP-expressing vector.