Log In Sign up
The largest database of trusted experimental protocols

Cl075

Manufactured by InvivoGen
Visit Supplier
Sourced in United States, France

CL075 is a toll-like receptor 7 (TLR7) agonist. It is a synthetic compound that can stimulate the immune system by activating TLR7, which is involved in the recognition of viral RNA.

Automatically generated - may contain errors

Lab products found in correlation

Poly 1 c, by InvivoGen (6 mentions) Lipopolysaccharides (lps), by Merck Group (5 mentions) Pam3csk4, by InvivoGen (5 mentions) Lipopolysaccharides (lps), by InvivoGen (4 mentions) Zombie amine dye, by BioLegend (4 mentions) Alexa fluor 594 and alexa fluor 488 conjugated secondary antibodies, by Thermo Fisher Scientific (2 mentions) Hrp conjugated secondary antibody, by GE Healthcare (2 mentions) Smi 312r, by Fortrea (2 mentions) Brefaldin a, by Thermo Fisher Scientific (2 mentions) Imiquimod, by InvivoGen (2 mentions) Flagellin, by InvivoGen (2 mentions) Brefeldin a, by Thermo Fisher Scientific (2 mentions) Dynabead, by Thermo Fisher Scientific (2 mentions) Lipopolysaccharide lps, by Merck Group (2 mentions) Ultrapure lps, by InvivoGen (2 mentions) Cl097, by InvivoGen (2 mentions) Rpmi glutamax, by Thermo Fisher Scientific (1 mentions) Tl8 506, by InvivoGen (1 mentions) Ssrna40, by InvivoGen (1 mentions) 2 3 cgam ps 2 rp sp, by InvivoGen (1 mentions)

27 protocols using cl075

1

Stimulation of Dendritic Cells with Diverse Immune Modulators

Check if the same lab product or an alternative is used in the 5 most similar protocols
Enriched blood DCs or sorted cord blood cDCs were resuspended at 1×106 cells/mL, PBMCs or tumor digests were resuspended at 5–10×106 cells/mL in DC medium (RPMI GlutaMAX, Gibco, #72 400–021, 1% human serum, Sigma, #H4522, 1% Pen/Strep). 1×105 cells (enriched blood DCs or sorted cord blood cDCs) or 0.5–1×106 cells (PBMCs or tumor digests) in 200 µL/well were treated with the indicated stimuli in a 96-well plate at 37°C in a CO2 incubator. For DC activation in the presence of tumor-conditioned medium, 1:1 diluted supernatant from a 6-hour culture of patient-derived tumor digest in DC medium or a 2-day culture of COR-L105 tumor cell line (ECACC, #92031918) in RPMI GlutaMAX, 10% FBS, 1% Pen/Strep was added to sorted cord blood cDCs during stimulation. The following concentrations were used: 10'000 U/mL huIFN-α (R&D, #11100–1), 10'000 U/mL huIFN-β (R&D, #8499-IF-010), 1 µg/mL huIFN-λ (R&D, #1598-IL-025), 50'000 U/mL huIFN-γ (PeproTech, #300–02), 1 µg/mL Pam3CSK4 (Invivogen, #vac-pms), 10 µg/mL Poly(I:C) (Invivogen, #vac-pic), 0.1 µg/mL LPS (Sigma, #L2880), 1 µM TL8-506 (Invivogen, #tlrl-tl8506), 10 µM CL075 (Invivogen, #tlrl-c75), 10 µM R848 (Invivogen, #vac-r848), 10 µg/mL ssRNA40 (Invivogen, #tlrl-lrna40), 10 µg/mL 2’3’-cGAM(PS)2(Rp/Sp) (Invivogen, #tlrl-nacga2srs).
He M., Soni B., Schwalie P.C., Hüsser T., Waltzinger C., De Silva D., Prinz Y., Krümpelmann L., Calabro S., Matos I., Trumpfheller C., Bacac M., Umaña P., Levesque M.P., Dummer R., van den Broek M, & Gasser S. (2022). Combinations of Toll-like receptor 8 agonist TL8-506 activate human tumor-derived dendritic cells. Journal for Immunotherapy of Cancer, 10(6), e004268.
+ Open protocol
+ Expand
2

Innate Immune Response to Bacterial and Viral Stimuli

Check if the same lab product or an alternative is used in the 5 most similar protocols
Innate stimuli (PRR ligands) representative of bacterial and viral stimuli were used for short term in vitro stimulation of fresh PBMC directly ex vivo. Briefly, PBMC obtained 24 h post‐partum were isolated using Ficoll (GE Healthcare, Mississauga, Canada) gradients, cultured in triplicate at 350,000 cells/well with 200 μL medium alone and in the presence of a TLR4 ligand (0.4 ng/mL LPS, InvivoGen, San Diego, CA), TLR8 ligand (400 ng/mL CL075, InvivoGen), TLR3 ligand (50 µg/mL poly(I:C), InvivoGen) or RLR ligand (100 ng/mL poly(I:C)/Lyovec, InvivoGen). Supernatants were harvested after 24 h culture and stored at −20°C.
Graham C., Thorleifson M., Stefura W.P., Funk D.J, & HayGlass K.T. (2017). Class II obese and healthy pregnant controls exhibit indistinguishable pro‐ and anti‐inflammatory immune responses to Caesarian section. Immunity, Inflammation and Disease, 5(3), 364-372.
+ Open protocol
+ Expand
3

Immunohistochemical Analysis of Neuronal Signaling

Cited 3 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
The antibodies and reagents used in this study were as follows: GFP (A6455; rabbit; Invitrogen; Chen et al., 2011 (link)); MAP2 (AB5622; rabbit; EMD Millipore; Chen et al., 2011 (link)); MAP2 (M4403; mouse; Sigma-Aldrich; Chen et al., 2011 (link)); SMI-312R (SMI-312R; mouse; Covance; Liu et al., 2013 (link)); HA (3F10; rat; Roche; Chen et al., 2017 (link)); phospho-P38 MAPK (9211; rabbit; Cell Signaling Technology); rabbit polyclonal P38 MAPK antibody (9212; rabbit; Cell Signaling Technology); phospho-ERK (4376; rabbit; Cell Signaling Technology); ERK (4695; rabbit; Cell Signaling Technology); phospho-JNK (9251; rabbit; Cell Signaling Technology); JNK (9252; rabbit; Cell Signaling Technology); phospho-TAK1 (9339; rabbit; Cell Signaling Technology); GAPDH (sc-25778; rabbit; Santa Cruz Biotechnology, Inc.; Chen et al., 2011 (link)); NeuN (MAB377; mouse; EMD Millipore; Wang et al., 2015 (link)); HRP-conjugated secondary antibodies (GE Healthcare); and Alexa Fluor 488– and Alexa Fluor 594–conjugated secondary antibodies (Invitrogen). Antibodies with validation profiles in Antibodypedia or 1DegreeBio are underlined. CL075, poly dT, poly(I:C) high molecular weight, and SB203580 were all purchased from InvivoGen. Takinib and NG 25 were purchased from Medchem Express, and (5Z)-7-oxozeaenol was purchased from Tocris.
Hung Y.F., Chen C.Y., Shih Y.C., Liu H.Y., Huang C.M, & Hsueh Y.P. (2018). Endosomal TLR3, TLR7, and TLR8 control neuronal morphology through different transcriptional programs. The Journal of Cell Biology, 217(8), 2727-2742.
+ Open protocol
+ Expand
4

Modulating PBMC Activation Pathways

Check if the same lab product or an alternative is used in the 5 most similar protocols
The 3 × 106 PBMCs from healthy donors or individuals carrying heterozygous IKZF1 mutation were cultured in the presence poly(I:C) (10 μg/ml, Invivogen), LPS (5ng/ml, Sigma), CL075 (1 μg/ml, Invivogen) and CpG (ODN 2216, 7.5 μΜ, Invivogen) with or without IFN-α (3000 IU/ml, R&D), with or without anti-CD303 and anti-CD304 (Biolegend), with or without 0.1, 1 or 10 μM lenalidomide (Sigma). Cells were cultured for 14 h at 37 oC, 5% CO2, with addition of Brefaldin A (10 μg/ml, eBioscience) after 3 h. For dead-cell exclusion (usually <30%) cells were stained with Zombie amine dye (Biolegend), surface markers and then intracellular cytokines antibodies after fixation and permeabilization (eBioscience), as above.
Cytlak U., Resteu A., Bogaert D., Kuehn H.S., Altmann T., Gennery A., Jackson G., Kumanovics A., Voelkerding K.V., Prader S., Dullaers M., Reichenbach J., Hill H., Haerynck F., Rosenzweig S.D., Collin M, & Bigley V. (2018). Ikaros family zinc finger 1 regulates dendritic cell development and function in humans. Nature Communications, 9, 1239.
+ Open protocol
+ Expand
5

Genetic Manipulation of 3T3 Cell Line

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were stimulated the day following plating with Poly(I:C) HMW (Invivogen), E.coli 0111:B4 LPS purified by gel filtration (Sigma), R848 (Invivogen), CL075 (Invivogen), NDV-GFP (Park et al., 2003 (link)), or VSV Indiana strain at concentrations listed in figure legends. 3T3 Xaf1−/− cells were generated by cloning the guide sequences AGCTTCCTGCAGTGCTTCTGTGG and AGGCTGACTTCCAAGTGTG CAGG located in exon 1 of Xaf1 into pSpCas9n(BB)-2A-GFP, and transfecting into 3T3 cells using LTX (Invitrogen). Single cell clones were obtained by limiting dilution and screened by PCR using the primers listed in Table S5 and the PCR conditions 95° 30 s, 60.2° 30 s, 72° 30 s, Surveyor assay (as above), and western blot.
Uccellini M.B., Bardina S.V., Sánchez-Aparicio M.T., White K.M., Hou Y.J., Lim J.K, & García-Sastre A. (2020). Passenger Mutations Confound Phenotypes of SARM1-Deficient Mice. Cell reports, 31(1), 107498.
+ Open protocol
+ Expand
6

Silencing Innate Immune Regulators

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA interference was performed by lipofection (RNAiMax, Life Technologies) of 5 nM Silencer Select siRNAs (Life Technologies) for 72 h. Cells were stimulated for 14 h with CpG2006 (Metabion), R848 (InvivoGen), CL075 (InvivoGen), Pam2CSK4 (EMC microcollections), human TNF or IL-1β (R&D systems), TLR7-specific RNA (5′-ACUG1CG1AG1CUU-X-UUCG1AG1CG1UCA-5, G1 is 7-deazaguanosine, X is 1,2,3-propanetriol) (14 (link)) or TLR8-specific RNA (5′-YUGCUGCCUUUG-X-GUUUCCGUCGUY-5′, Y is 1,3-propanediol, X is 1,2,3-propanetriol) (15 (link)) (Idera Pharmaceuticals). Supernatants were analyzed by ELISA for hIL-8 (BD Biosciences), hIL-6 or hTNF (R&D Systems). Efficiency of RNA interference was analyzed by SYBR Green quantitative PCR (qPCR) for MyD88, AP1M1 and AP2M1 expression normalized to HPRT.
Pelka K., Phulphagar K., Zimmermann J., Stahl R., Schmid-Burgk J.L., Schmidt T., Spille J.H., Labzin L.I., Agrawal S., Kandimalla E., Casanova J.L., Hornung V., Marshak-Rothstein A., Höning S, & Latz E. (2014). The UNC93B1 tyrosine-based motif regulates trafficking and TLR responses via separate mechanisms. Journal of immunology (Baltimore, Md. : 1950), 193(7), 3257-3261.
+ Open protocol
+ Expand
7

Monocyte Cytokine Production Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
A total of 100,000 sorted blood monocytes or 200,000 immunomagnetically purified bone marrow monocytes were cultured in RPMI 1640 (Sigma–Aldrich, Schnelldorf, Germany) supplemented with L-glutamine (100 μg/mL), gentamycin (20 μg/mL) and 20% heat-inactivated fetal calf serum (FCS). The cells were stimulated with 100 ng/mL lipopolysaccharide (LPS) (InVivogen, San Diego, CA, USA) or 1 μg/mL CL075 (InVivogen) for 12 h in 100 μL in a 96 well flat bottomed tissue culture plate (Sigma-Aldridge, Costar). Cytokines were measured in the supernatant by Mulitplex or ELISA.
Sponaas A.M., Moen S.H., Liabakk N.B., Feyzi E., Holien T., Kvam S., Grøseth L.A., Størdal B., Buene G., Espevik T., Waage A., Standal T, & Sundan A. (2015). The proportion of CD16+CD14dim monocytes increases with tumor cell load in bone marrow of patients with multiple myeloma. Immunity, Inflammation and Disease, 3(2), 94-102.
+ Open protocol
+ Expand
8

Isolation and Culture of Rhesus Macaque Microglia

Check if the same lab product or an alternative is used in the 5 most similar protocols
Primary adult rhesus macaque (Macaca mulatta) microglia cultures were isolated from post mortem brain tissue and cultured as described previously (Burm et al., 2015). Briefly, male or female rhesus macaque monkeys (4–9 years old) without neurological symptoms were housed in outbred breeding colonies. No monkey was sacrificed exclusively for the generation of the primary cultures. Cubes of 3 g of subcortical white matter brain tissue were mechanically and enzymatically dissociated and centrifuged. A percoll gradient was used to remove myelin; other CNS cells and erythrocytes were removed by exposure to hypotonic solution. Isolated microglia were cultured in DMEM (high glucose)/HAM F10 Nutrient Mixture (supplemented with 10% v/v heat‐inactivated FCS, 0.5 mm glutamax, 50 U/ml penicillin, and 50 μg/ml streptomycin) (Thermo Fisher). After 24 hr, nonadherent cells and cellular debris were removed and fresh medium containing 20 ng/ml macrophage colony‐stimulating factor (M‐CSF) (Peprotech) was added. After 7 days in culture, microglia were treated for 16 hr with 500 ng/ml Pam3CSK4 (Invivogen), 20 μg/ml Poly I:C (Invivogen), 100 ng/ml LPS (E. coli 026:B6, Sigma‐Aldrich, L8274), or 1 μg/ml CL075 (Invivogen, #tlrl‐c75).
Borggrewe M., Grit C., Den Dunnen W.F., Burm S.M., Bajramovic J.J., Noelle R.J., Eggen B.J, & Laman J.D. (2018). VISTA expression by microglia decreases during inflammation and is differentially regulated in CNS diseases. Glia, 66(12), 2645-2658.
+ Open protocol
+ Expand
9

PBMC Stimulation with TLR Agonists

Check if the same lab product or an alternative is used in the 5 most similar protocols
PBMC (2×106/ml) were cultured with 167nM or 500nM Motolimod (VentiRx Pharmaceuticals) or PBS for 24 hours. In some assays, the cells were cultured with 0.5uM and 2uM of TLR7/8 agonist CL-075, 10uM and 50uM of TLR7 agonist Imiquimod, and 50nM and 100nM of TLR 9 agonist CpG ODN2006 with PBS control (all InvivoGen). Doses were optimized as previously reported [16 (link)].
Dang Y., Rutnam Z.J., Dietsch G., Lu H., Yang Y., Hershberg R, & Disis M.L. (2017). TLR8 ligation induces apoptosis of monocytic myeloid‐derived suppressor cells. Journal of Leukocyte Biology, 103(1), 157-164.
+ Open protocol
+ Expand
10

Molecular Signaling Pathway Activators

Check if the same lab product or an alternative is used in the 5 most similar protocols
Dimethylsulfoxide (DMSO), phorbol-12-myristate-13-acetate (PMA), and bacterial lipopolysaccharide (LPS) from Escherichia coli O127:B8 were obtained from Sigma (St. Louis, MO). TLR ligands CL075 and polyinosinic:polycytidylic acid (poly(I:C)) were purchased from InvivoGen (San Diego, CA). LPS is the major structural component of the outer wall of all Gram-negative bacteria and recognized by TLR4. CL075 is a thiazoloquinolone derivative that stimulates TLR8 in human peripheral blood mononuclear cells and poly(I:C) is a synthetic analog of double-stranded RNA, a molecular pattern associated with viral infection and TLR3 activation. TCDD (>99% purity) was originally obtained from Dow Chemical Co. (Midland, MI). Other molecular biological reagents were purchased from Qiagen (Valencia, CA) and Roche Clinical Laboratories (Indianapolis, IN). The polyclonal RelB (Santa Cruz Biotechnology, Inc., Santa Cruz, CA), polyclonal AhR (Novus Biologicals, Littleton, CO; Abnova, Walnut, CA), and the monoclonal CDX2 (Developmental Studies Hybridoma Bank, University of Iowa, IA) antibodies were used for Western blot analyses.
Kado S., Chang W.L., Chi A.N., Wolny M., Shepherd D.M, & Vogel C.F. (2016). Aryl hydrocarbon Receptor signaling modifies Toll-like receptor-regulated responses in human dendritic cells. Archives of toxicology, 91(5), 2209-2221.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!