Double strand cdna synthesis kit

Total cellular RNA was isolated using RNAiso reagent (Takara, Dalian, China) and quantified by measuring the absorbance at 260 nm (NanoDrop 2000; Thermo Fisher Scientific, Waltham, MA, USA). Total RNA (≤1000 ng) was reverse-transcribed into cDNA in a reaction volume of 20 μL using the Double-Strand cDNA Synthesis Kit (Takara, Dalian, China). One microliter of cDNA was used as the template for the qPCR reaction. All gene transcripts were quantified by qPCR using the Power SYBR® Green PCR Master Mix (Takara) on the ABI StepOnePlus System (Applied Biosystems, Warrington, UK). The mRNAs of the target genes and the housekeeping gene (18S) were quantified in separate tubes. All primers were synthesized by Sangon Biotech (Shanghai, China). The primer sequences used are shown in Table 1. The cycle conditions were as follows: 95 °C for 30 s and then 40 cycles of 95 °C for 5 s and 60 °C for 30 s. The relative target gene expression levels were calculated using the 2^−△△Ct method.

Total cellular RNA was isolated using RNAiso reagent (Takara, Dalian, China) and quantified by measuring the absorbance at 260 nm (NanoDrop 2000; Thermo Fisher Scientific, Waltham, MA, USA). Total RNA (≤1000 ng) was reverse-transcribed into cDNA in a reaction volume of 20 μL using the Double-Strand cDNA Synthesis Kit (Takara, Dalian, China). One microliter of cDNA was used as the template for the qPCR reaction. All gene transcripts were quantified by qPCR using the Power SYBR Green PCR Master Mix (Takara) on the ABI StepOnePlus System (Applied Biosystems, Warrington, UK). The mRNAs of the target genes and GAPDH were quantified in separate tubes. All primers were synthesized by Sangon Biotech (Shanghai, China). The primer sequences used are shown in Table 1. The cycle conditions were as follows: 95 °C for 30 s and then 40 cycles of 95 °C for 5 s and 60 °C for 30 s. The relative target gene expression levels were calculated using the 2^−ΔΔCt method.

RT-PCR was performed after 24 h incubation in the acidic conditions. RNA was extracted using TRIzol reagent (TAKARA, Dalian, China) as previously described [27 (link)]. Total RNA was reversely transcripted to cDNA utilizing a Double-Strand cDNA Synthesis Kit (TAKARA) according to the manufacturer's instructions. SYBR Green PCR assays (TAKARA) were used to perform real-time PCR in StepOnePlus (Applied Biosystems, USA). Three independent samples were set to ensure validity. 18S rRNA was used as internal control, and target genes were detected (Table 1). Primers were synthesized by Sangon Biotech (Shanghai, China), and quantitative real-time PCR data were calculated by the 2^−ΔΔCt method. PCR assays were conducted at least three times in triplicates for each sample.

Total RNA of H9c2 cells was extracted using TRIZOL (Invitrogen, Carlsbad, CA), following the procedure of standard protocol. Reverse transcription was performed using a Double-Strand cDNA Synthesis Kit (Takara, Dalian, China). qPCR was performed using a SYBR Green Master Mix kit (Takara). Primers were synthesized and obtained from Sangon Biotech (Shanghai, China). The details of primers used in this study were listed in Table S1.

Total cellular RNA was isolated using RNAiso reagent (Takara, Dalian, China) and quantified by measuring the absorbance at 260 nm (NanoDrop 2000; Thermo Fisher Scientific). Total RNA ( ≤ 1000 ng) was then reverse-transcribed into cDNA in a reaction volume of 10 μl using a Double-Strand cDNA Synthesis Kit (Takara). All gene transcripts were quantified by qPCR using the Power SYBR^® Green PCR Master Mix (Takara) on the ABI StepOnePlus System (Applied Biosystems, Warrington, UK). 18 S was used as a housekeeping gene. The mRNAs of the target genes and the housekeeping gene were quantified in separate tubes. All primers used in this study were synthesised by Sangon Biotech (Shanghai, China), the primer sequences of which were shown in Table 1. The cycle conditions of qPCR were set as follows: 95 °C for 30 s and then 42 cycles of 95 °C for 5 s and 60 °C for 30 s. The 2^−△△Ct method was used to calculate the relative expression levels of target genes.Table 1

Sequences of primers for quantitative real-time PCR

Gene	Reverse (5′–3′)	Reverse (3′–5′)
FOXA2	CACGGCTCCCAGCATACTTT	CACGGCTCCCAGCATACTTT
ALP	GCCGGCCCAAGAGAGAA	CCGATGGGACCGTGGTT
RUNX2	CAGCAGAGGCATTTCGTAGCT	CATCGGTGGTACTAAC
COL1A1	CTGGATCATATTGCACA	GAGCTGCCCTGCACTGGGTG
OCN	TGGCCCCAGACCTCTTCCCG	TGGCCCCAGACCTCTTCCCG
OPN	CAGGCTGGCTTTGGAACT	CAGGCTGGCTTTGGAACT
18 S	TTGACGGAAGGGCACCA	TTGACGGAAGGGCACCA

Total RNA was isolated from cells cultured with OIM using RNAiso reagent (Takara Bio Inc., Dalian, China) and quantified by measuring the A₂₆₀ (NanoDrop 2000; Thermo Fisher Scientific, Waltham, MA, United States of America). First strand cDNA was synthesized using PrimeScript RT Master Mix (Takara Bio Inc.) according to the manufacturer’s instructions. Total RNA (≤1,000 ng) was reverse-transcribed into cDNA in a reaction volume of 20 μL using a Double-Strand cDNA Synthesis Kit (Takara Bio Inc.). The levels of mRNAs encoding COL1A1, RUNX2, OCN and GAPDH were determined using a StepOnePlus real-time PCR system (Applied Biosystems Inc., Warrington, United Kingdom) and SYBR Premix Ex Taq (Takara Bio Inc.) under the following conditions: 95°C for 30 s followed by 40 cycles of 95°C for 5 s and 60°C for 30 s. GAPDH was used as an internal control and allowed adjustment of differences among samples. DNA concentrations were calculated using the 2^−ΔΔCt method (Livak and Schmittgen 2001 (link)). All primers used in this experiment were synthesized by Sangon Biotech and are listed in Table 1.