7500 fast real time pcr detection system

Total RNA extraction was done with TRIzol reagent (Life Technologies Corporation, Grand Island, NY). RNA was transcribed into cDNA with SuperScript® III First-Strand Synthesis SuperMix (Life Technologies Corporation, Grand Island, NY) and analyzed with SYBR green (Applied Biosystems, Inc., Grand Island, NY) on the 7500 FAST Real Time PCR detection system (Applied Biosystems, Inc., Grand Island, NY). The human primers used are: ACTB, forward: 5-ggacttcgagcaagagatgg-3′, reverse: 5′-agcactgtgttggcgtacag-3’; XBP1_S, forward: 5′- ctgagtccgcagcaggtg -3′, reverse: 5′- ggctggtaaggaactgggtc -3′; DNAJC3, forward: 5′- actgaggcctgagcgaga -3′, reverse: 5′- gcaggaaggggaataccgag -3′; CHOP, forward: 5′- agaaccaggaaacggaaacaga -3′, reverse: 5′- tctccttcatgcgctgcttt -3′; SEL1L, forward: 5′- gagaatacggctgcctgatgaag -3′, reverse: 5′- caggtgcagttgtccaagacca -3′; HMOX1, forward: 5′- ccaggcagagaatgctgagttc -3′, reverse: 5′- aagactgggctctccttgttgc -3′; GPX2, forward: 5′- acttcacccagctcaacgag -3′, reverse: 5′- atgctcgttctgcccattca -3′; NQO1, forward: 5′- cctgccattctgaaaggctggt -3′, reverse: 5′- gtggtgatggaaagcactgcct -3′; NRF2, forward: 5′- cacatccagtcagaaaccagtgg -3′, reverse: 5′- ggaatgtctgcgccaaaagctg -3′; P16, forward: 5′- ctcgtgctgatgctactgagga -3′, reverse: 5′- ggtcggcgcagttgggctcc -3′; P21, forward: 5′- aggtggacctggagactctcag -3′, reverse: 5′- tcctcttggagaagatcagccg -3′;

Total RNA was extracted from the heart tissue using TRIzol (Invitrogen). After DNAse treatment, 500 ng of total RNA was reverse transcribed using the High-Capacity cDNA Archive Kit (Applied Biosystems). The expression of BNP, Col1α1 and Col3α1, β1 and β2 adrenoceptors (β1-AR and β2-AR), angiotensin II receptor type 1 (AT1R), and angiotensin II receptor type 2 (AT2R) was determined by real-time quantitative PCR using a 7500 Fast Real-Time PCR detection system (Applied Biosystems), and the results were analysed using the 2-ΔΔ^CT method (Livak and Schmittgen, 2001 (link)). All primers were obtained from Qiagen. GAPDH and β-actin were used as internal controls.

Specific primers for quantitative PCR (qPCR) analyses of target genes (cgα, fshβ, and lhβ) were designed and examined for their specificity and amplification efficiency on serial dilutions of respective target gene plasmid DNA (10³-10⁸ copies/μl) (Supplemental Table 1). All qPCR was performed in a 20 μl reaction mixture on the 7500 FAST real-time PCR detection system (Applied Biosystems, USA) using default settings. The relative mRNA levels of the target genes were determined using the comparative Ct method (24 (link)) with the β-actin gene as an internal control. Transcript levels of β-actin gene were stable (Supplemental Figure 1). The specificity and efficiency of the specific primers for β-actin and progestin receptors have been described and validated in previous studies (25 (link), 20 (link)).

Twenty-eight PA samples were surgically resected in the Department of Neurosurgery, Hospital of Lithuanian University of Health Sciences Kaunas Clinics (Lithuania), and were confirmed histologically. PA tissue samples were snap-frozen in liquid nitrogen prior to RNA extraction. Total RNA was purified using TRIzol Reagent (Ambion, Life Technologies). cDNA synthesis was performed using total RNA (2 μg) and random hexamer primers (ThermoFisher Scientific) with the RevertAid H Minus M-MuLV Reverse Transcriptase (ThermoFisher Scientific) in a final volume of 40 μL, according to the manufacturer's recommendations. For inhibition of mRNA degradation RiboLock RNase inhibitor (ThermoFisher Scientific) was used. MMP-9 mRNA expression was analyzed using quantitative real-time RT-PCR TaqMan probe assay (assay number Hs00234579_m1) in 3 replicates on 7500 Fast Real-Time PCR detection system (Applied Biosystems). One endogenous control (GAPDH TaqMan probe assay number Hs0 2758991_g1) was used. MMP-9 expression levels in PA were determined by the comparative Ct method (2^−ΔΔCt). The expression of MMP-9 was normalized to GAPDH and calibrated using reference sample (“FirstChoice Human Brain Reference RNA” (Ambion)).

RNA was extracted using an RNeasy mini kit (Qiagen). A SuperScript® VILOTM (Invitrogen/Life Technologies) cDNA synthesis kit was used to reverse transcribe cDNA from total RNA according to manufacturer's instructions. Quantitative PCR was performed using 7500 Fast Real-Time PCR detection system (Applied Biosystems). Reactions (25 μl each) were prepared in triplicate in a 96-well reaction plate. Each reaction contained 20 ng cDNA, 200 nM of each primer, 10 μl water and 12.5 μl Absolute Blue QPCR SYBR low ROX Mix (Thermo Scientific). DNA levels were normalized to the GAPDH calculated using a 2-ΔΔCt method. QPCR settings were as follows: Initialization at 95°C for 15 min, denaturation at 95°C for 15 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s and repeat for 40 cycles. Primers used for the qRT-PCR are listed below:
qRT-PCR F: 5′-AGT CGC ACA CTG CTA CAG GAC GA-3′
qRT-PCR R: 5′-GGC ACA AAG GCA TGT CGC ATG C-3′

RNA isolater Total RNA Extraction Reagent (R401-01, Vazyme, Nanjing, China) was used to extract total RNA from the samples. Total mRNA was reverse transcribed using the PrimeScript™ RT reagent kit with gDNA Eraser to generate cDNA (Takara, Japan). Quantitative PCR was performed using SYBR Green (Takara, Japan) and a 7500 Fast Real-Time PCR detection system (Applied Biosystems, CA, United States). The sequences of the quantitative PCR primers are shown in Table 1.