Tumor necrosis factor (tnf)

Experiments in THP-1 cells were based on methods previously described and expanded upon (97 (link)). After growth to approximately 8 × 10⁵ cells/ml in C-RPMI, monocyte-like THP-1 cells were pelleted by centrifugation at 200 × g for 5 min and resuspended in C-RPMI to a concentration of 1 × 10⁶ cells/ml. PMA was then added to a final concentration of 50 nM, and the cells were seeded in 48-well tissue culture plates at 4 × 10⁵ cells/well. Commercial LPS (LPS-EB from E. coli O111:B4; InvivoGen) at 10 ng/ml, purified LOS at 10 ng/ml, or paraformaldehyde-treated bacteria at different multiplicities of infection (MOI) were added to the wells during this time for training. The cells were allowed to differentiate for 24 h into a macrophage-like phenotype before the medium was discarded and replaced with fresh C-RPMI, and they were rested for 16 h before challenge with C. jejuni HS:19 at an MOI of 5. After 24 h of challenge, the supernatants were removed and cytokine production measured using TNF (BD-Biosciences), IL-6 (BD-Biosciences), or IL-1β (Invitrogen) enzyme-linked immunosorbent assay (ELISA) kits. Cytokine production was measured with technical duplicates in each of several biological replicates.

Skin from MC903- or IMQ-treated mice was homogenized in pre-cooled PBS, pH 7.4, by using Beadbeater (Biospec), and the supernatants of skin homogenate were collected for cytokine evaluation. Cytokine production was measured by ELISA kits of IL-4 (Multisciences (Lianke) Biotech Co., Ltd.), IL-13 (eBioscience), TSLP (Multisciences (Lianke) Biotech Co., Ltd.), IL-23 (R&D), IL-17A (R&D), CCL20 (R&D), CXCL1 (R&D), IL-17F(BD Pharmingen) and TNF (BD Pharmingen) according to the manufacturer’s instructions. The samples with a low yield of protein were predetermined and excluded.

Secretion of IL-12p40, IL-10, TNF, IL-6, and MCP-I (BD Biosciences) was determined in medium from cultured BMDMs or in murine blood serum using a sandwich enzyme-linked immune sorbent assay (ELISA). All assays were performed according to the manufacturer’s instructions. Triplicate samples were analysed using an ELISA reader and compared to a standard curve.

PBMCs were prepared from buffy coats by density gradient centrifugation, as previously described [21 (link)]. THP-1 cells were electroporated with a plasmid expressing EF1α promoter-driven Cas9-NLS-2A-EGFP and U6-driven guide RNA targeting BATF2 [CGGGTTCCTGTTACCCAGCTC], sorted for eGFP-positive cells, and selected via limited dilution, as previously described [22 (link)]. Genotypes were validated by Sanger sequencing (Figure S1). PBMCs and THP-1 cells were stimulated with herring testes DNA (dsDNA; Sigma-Aldrich/Merck, Darmstadt, Germany), 3pdsRNA, generated by in vitro transcription, as previously described [23 (link)], 9.2s RNA (Biomers, Ulm, Germany), Pam3CysK4, ultrapure LPS, flagellin, R848, and CpG2216 (all from InvivoGen, Toulouse, France), as indicated. Prior to stimulation, dsDNA and 3pdsRNA were complexed with Lipofectamine 2000 (Invitrogen/Thermo Scientific, Waltham, MA, USA), and 9.2 s RNA was complexed with poly-L-Arginin (Sigma-Aldrich/Merck, Darmstadt, Germany). Cellular supernatants were then harvested for ELISA probing for IFN-α, IFN-β (Hölzel Diagnostika, Cologne, Germany), TNF, IL-12p40, CXCL10, IL-8, IL-6 (BD Biosciences, Franklin Lakes, NJ, USA), and IL-23 (Human IL-23 HTRF Kit, CisBio, Codolet, France). RNA was isolated, as previously described [24 (link)].

Supernatants of lung cell cultures were collected at 24 h and assayed for TNF, IL-10, IL-4, IFN-γ, IL-12p70 (BD Bioscience, San Diego, CA, USA), IL-13 (Biosource, Camarillo, CA, USA) and IL-17AF (e-Bioscience, Invitrogen, ThermoFisher scientific, San Diego, CA, USA) production by sandwich ELISA according to the manufacturers’ instructions supplied with the cytokine-specific kits.