DNA was extracted from a sample of the original WT phiIPLA-RODI phage lysate and 5 different phiIPLA-RODI samples grown on the CRISPR-Cas-positive 110900 strain for 24 h in the bioscreen experiments, using the GenElute bacterial genomic DNA extraction kit (Sigma-Aldrich), using the standard protocol with 200 μL phage lysate taken directly from the bioscreen plates. All isolates were subjected to whole-genome sequencing on an Illumina MiSeq platform with 2 × 251-bp paired-end reads. Sequences were assembled to the reference phiIPLA-RODI genome (NC_028765 ) using Geneious Prime with the BBDUK trimmer plug-in. SNPs and variations were called using Geneious Prime, excluding regions of high or low coverage, with any SNPs/variations present in the WT sample being excluded from further analysis.
Genelute bacterial genomic dna extraction kit
Manufactured by Merck Group
Sourced in United States
The GenElute bacterial genomic DNA extraction kit is a laboratory equipment product designed for the efficient extraction and purification of genomic DNA from bacterial samples. It provides a streamlined protocol for the isolation of high-quality DNA that can be used in various downstream applications.
Automatically generated - may contain errors
Lab products found in correlation
Miseq platform, by Illumina (2 mentions)
Qubit fluorometer, by Thermo Fisher Scientific (2 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (2 mentions)
T4 dna ligase, by Thermo Fisher Scientific (2 mentions)
Quant it picogreen dsdna assay, by Thermo Fisher Scientific (1 mentions)
Phusion high fidelity dna polymerase, by Thermo Fisher Scientific (1 mentions)
Genejet plasmid miniprep kit, by Thermo Fisher Scientific (1 mentions)
Nebuilder hifi dna assembly kit, by New England Biolabs (1 mentions)
Restriction enzyme, by Thermo Fisher Scientific (1 mentions)
Dreamtaq dna polymerase, by Thermo Fisher Scientific (1 mentions)
Zymoclean gel dna recovery kit, by Zymo Research (1 mentions)
Truseq nano dna sample preparation kit, by Illumina (1 mentions)
Hiseq 2500, by Illumina (1 mentions)
Nextera xt, by Illumina (1 mentions)
10 protocols using genelute bacterial genomic dna extraction kit
1
Whole-Genome Sequencing of CRISPR-Cas Phage Mutants
2
Genomic DNA Extraction from Alcaligenes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA from Alcaligenes sp. strain 13f was extracted from the culture grown in glucose/yeast-extract broth at 20 °C for 5 days by using the GenElute Bacterial Genomic DNA Extraction Kit (Sigma, St Louis, MO, USA). The DNA was examined on an agarose gel and quantified by using the Quant-iT PicoGreen dsDNA assay (Thermo Scientific, Loughborough, UK) in a Nanodrop spectrophotometer (NanoDrop 3300, Thermo Scientific, Loughborough, UK).
3
Bacterial DNA Extraction from Root Nodules
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The stored nodules were rehydrated by soaking in sterilized distilled water, surface-sterilized as described by Somasegaran & Hoben [49] and transferred into 2-ml volume of microcentrifuge tubes. Each single nodule was crushed in a drop of sterilized distilled water using a sterile plastic pestle. The DNA was extracted directly from the nodules using GenElute bacterial genomic DNA extraction kit (Sigma-Aldrich, USA). The DNA purity and concentration was checked using 0.8% agarose gel stained with ethidium bromide in horizontal gel electrophoresis. The extracted nodule bacterial DNA samples were stored at −20 °C for later use.
4
Bacterial Genomic DNA Extraction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA (gDNA) was extracted from 25 ml 7 day old cultures using the GenElute Bacterial Genomic DNA Extraction kit (Sigma-Aldrich) following the protocol for Gram-positive bacteria with slight modification. Cultures were centrifuged for 15 min at 4 000 r.p.m. and resuspended in 760 µl Gram-positive lysis solution before separating into 4×190 µl aliquots to process in four columns. The protocol was then followed with an extended 16 h step in lysis solution and addition of proteinase K. DNA was concentrated by ethanol precipitation and pooled for each 25 ml culture.
5
Bacterial Genomic DNA Extraction and ERIC-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA of the bacterial isolates was extracted from bacterial cells grown in YM broth until the late log phase (109 cell.ml−1) using the GenElute bacterial genomic DNA extraction kit (Sigma-Aldrich, USA) according to the manufacturer’s instructions. After DNA extraction, the ERIC (enterobacterial repetitive intergenic consensus) PCR was carried out to amplify the genomic region of isolates using universal primers (Supplementary Table S3 ). A 25 µl master mix was prepared containing 12.5 µl (2X) myTaq PCR reaction buffer, 1.25 µl each primer pair, 9 µl of nuclease-free PCR water and 1 µl (40–50 ng/µl) of the extracted DNA. The reaction mixture was incubated in a Thermal cycler (T100 Bio-RAD, USA) at standard temperature profiles (Supplementary Table S3 ). A total volume of 25 µl of the amplified product was mixed with 5 µl loading dye (5x) and then loaded onto 1.2% agarose gel stained with ethidium bromide in a gel electrophoresis system containing 1 X Tris-Acetate EDTA (TAE) and run at 85 V for 270 minutes. Gel imaging and documentation were done using the GEL DocTM 186 XR+ molecular imager (Bio-RAD, USA).
6
Bacterial Genomic DNA Extraction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from each E. coli isolate using the GenElute Bacterial Genomic DNA Extraction Kit (Sigma-Aldrich, St. Louis, MO, United States), according to the manufacturer’s instructions. Purity of the DNA was assessed using a NanoDrop spectrophotometer (Thermo Fisher, Ottawa, ON, Canada) and quantified using a Qubit Fluorometer (Thermo Fisher Scientific, Ottawa, ON, Canada).
7
Bacterial Genomic DNA Extraction and Plasmid Cloning
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmid DNA was purified
by using the GeneJET Plasmid Miniprep Kit (Thermo Fisher Scientific).
Microbial genomic DNA was extracted by employing the GenElute Bacterial
Genomic DNA Extraction Kit (Sigma-Aldrich). To derive the gel-purified
linearized DNA, a Zymoclean Gel DNA Recovery Kit (Zymo) was used.
Phusion High-Fidelity DNA polymerase, DreamTaq DNA polymerase, restriction
enzymes, and T4 DNA Ligase were purchased from Thermo Fisher Scientific.
NEBuilder HiFi DNA assembly kit was purchased from New England Biolabs.
All reactions were set up according to the manufacturer’s protocol.
Chemically competent E. coli were prepared
and transformed using a heat-shock method as described by.50 Electrocompetent C. necator and P. putida were prepared and transformed
using the electroporation method as described in ref52 . For transferring the
plasmids into P. putida, the antibiotic
resistance gene was changed from chloramphenicol to tetracycline by
using oligonucleotide primers IK003 and IK004 to amplify the tetracycline
resistance gene from pME6000 and cloned by AscI and PmeI restriction
sites into the required plasmids.
by using the GeneJET Plasmid Miniprep Kit (Thermo Fisher Scientific).
Microbial genomic DNA was extracted by employing the GenElute Bacterial
Genomic DNA Extraction Kit (Sigma-Aldrich). To derive the gel-purified
linearized DNA, a Zymoclean Gel DNA Recovery Kit (Zymo) was used.
Phusion High-Fidelity DNA polymerase, DreamTaq DNA polymerase, restriction
enzymes, and T4 DNA Ligase were purchased from Thermo Fisher Scientific.
NEBuilder HiFi DNA assembly kit was purchased from New England Biolabs.
All reactions were set up according to the manufacturer’s protocol.
Chemically competent E. coli were prepared
and transformed using a heat-shock method as described by.50 Electrocompetent C. necator and P. putida were prepared and transformed
using the electroporation method as described in ref52 . For transferring the
plasmids into P. putida, the antibiotic
resistance gene was changed from chloramphenicol to tetracycline by
using oligonucleotide primers IK003 and IK004 to amplify the tetracycline
resistance gene from pME6000 and cloned by AscI and PmeI restriction
sites into the required plasmids.
8
Genotypic Analysis of Pseudomonas Strains
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA of 120 fluorescent pseudomonads were extracted by GenElute Bacterial Genomic DNA Extraction kit (Sigma, USA), following the Manufacturer’s protocol. The DNA purity and quantity were checked by spectrophotometer at 260 and 280 nm. The genotypic analysis of 120 Pseudomonas strains were carried out by rep PCR using BOX-AIR1 primer (5′CTACGGCAAGGCGACGCTGACG3′) as described by Louws et al. 1994 [24] (link) as well as ERIC F (5′AAGTAAGTGACTGGGGTGAGCG3′) and ERIC R (5′TGTAAGCTCCTGGGGATTCAĆ) as mentioned earlier by de Bruijn, 1992 [25] (link) with three repetitions. A 10 µl PCR product together with 500 bp DNA marker (Bangalore Genei, Banglore, India) was separated on a 1.5% agarose gel stained with ethidium bromide in 1x TAE. A snapshot of the gel was taken by gel documentation system (UVP BioImaging system, Upland, California, USA) and stored as TIFF file for further analysis.
9
Genome sequencing of Bacillus subtilis strains
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The strain of B. s. subtilis KCTC 3135 T and B. s. spizizenii KCTC 3705 T used here were obtained from the Korean Collection for Type Cultures (KCTC) and cultured using Luria-Bertani (LB) medium (Difco) at 37 o C. The genomic DNA was extracted using a GenElute Bacterial Genomic DNA extraction kit (Sigma-Aldrich, USA). The library construction was performed by a TruSeq Nano DNA sample preparation kit and the genomic DNA was sequenced using HiSeq 2500 (Illumina, USA) and MiSeq (Illumina, USA) by a sequencing company (Chunlab, Korea).
10
Metagenomic Sequencing of Kilroot Salt Mine Brine
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Metagenomic DNA was extracted from a brine sample taken from Kilroot salt mine (54.7331° N, 5.7509° W).
Brine was sterile filtered using a 0.2 μm nitrocellulose filter membrane. This membrane was cut into several pieces and DNA was extracted using GenElute™ Bacterial Genomic DNA Extraction kit (Sigma-Aldrich, UK) as per manufacturer's instructions. A sample of extracted DNA was sent to MR DNA Lab (Shallowater, TX, USA) for sequencing library preparation (Nextera XT) and metagenomic sequencing on the Illumina MiSeq platform. with reads then trimmed of adaptors and quality-trimmed. The assembly of the processed reads into contigs was performed with SPAdes genome assembler v 3.10.1 [14] (link) in --meta mode with default parameters. Prodigal v2.6.3 [15] (link) was used to predict genes in the assembled contigs. BLAST [16, 17] (link) search with default parameters was carried out to identify full-length coding sequences homologous to the genes of amine TAms from Vibrio fluvialis (UniProt: F2XBU9) and Halomonas sp. CSM-2 (Refseq: WP_085918404.1). The pET28a(+)/KMG-TAm4 plasmid was synthesised via GenPlus cloning by GenScript, comprising the KMG-TAm4 gene sequence in pET28a(+) vector, with flanking NdeI and XhoI restriction sites. Plasmids were reconstituted in molecular grade water to a concentration of 0.2 μg/μL.
Brine was sterile filtered using a 0.2 μm nitrocellulose filter membrane. This membrane was cut into several pieces and DNA was extracted using GenElute™ Bacterial Genomic DNA Extraction kit (Sigma-Aldrich, UK) as per manufacturer's instructions. A sample of extracted DNA was sent to MR DNA Lab (Shallowater, TX, USA) for sequencing library preparation (Nextera XT) and metagenomic sequencing on the Illumina MiSeq platform. with reads then trimmed of adaptors and quality-trimmed. The assembly of the processed reads into contigs was performed with SPAdes genome assembler v 3.10.1 [14] (link) in --meta mode with default parameters. Prodigal v2.6.3 [15] (link) was used to predict genes in the assembled contigs. BLAST [16, 17] (link) search with default parameters was carried out to identify full-length coding sequences homologous to the genes of amine TAms from Vibrio fluvialis (UniProt: F2XBU9) and Halomonas sp. CSM-2 (Refseq: WP_085918404.1). The pET28a(+)/KMG-TAm4 plasmid was synthesised via GenPlus cloning by GenScript, comprising the KMG-TAm4 gene sequence in pET28a(+) vector, with flanking NdeI and XhoI restriction sites. Plasmids were reconstituted in molecular grade water to a concentration of 0.2 μg/μL.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!