Tripure total rna extraction reagent

Total RNA was extracted from cells using TRIpure Total RNA Extraction Reagent (ELK Biotechnology, Wuhan, China). cDNA was synthesized using an EntiLink™ First Strand cDNA Synthesis Kit (ELK Biotechnology, Wuhan, China). qRT-PCR was conducted using the EnTurbo™ SYBR Green PCR SuperMix. U6 and GAPDH served as internal references for normalization. Primer sequences are listed in Table 1.Table 1.

The primer sequences for qRT-PCR in our study

Gene	Forward	Reverse
GAPDH	5ʹCATCATCCCTGCCTCTACTGG3’	5ʹGTGGGTGTCGCTGTTGAAGTC3’
MT1F	5ʹCCACTGCTTCTTCGCTTCTCT3’	5ʹAAGGTTGTCCTGGCATCAGTC3’
MT1G	5ʹCTTCTCGCTTGGGAACTCTAGTC3’	5ʹGGTCAAGATTGTAGCAAAAAACAA3’
MT1H	5ʹCTCGCTTGGGAACTCCAGTC3’	5ʹGTTTTCATCTGACAGCAGGGC3’
MT1X	5ʹCGTGTTTTCCTCTTGATCGG3’	5ʹGCTGCACTTGTCTGACGTCC3’
P65	5ʹCGCATCCAGACCAACAACA3’	5ʹTGCCAGAGTTTCGGTTCAC3’
CyclinD1	5ʹTCCTACTTCAAATGTGTGCAGAAG3’	5ʹCATCTTAGAGGCCACGAACATG3’
miR-376a-3pU6	5ʹGGCATAGAGGAAAATCCACG3’5ʹCTCGCTTCGGCAGCACAT3’	5ʹCTCAACTGGTGTCGTGGAGTC3’5ʹAACGCTTCACGAATTTGCGT3’

Cells treated with or without KDM4D inhibitor were prepared for RNA extraction. Briefly, RNA was extracted by TRIpure total RNA extraction reagent (ELK Biotechnology, Wuhan, China). EntiLink™ 1st Strand cDNA Synthesis Kit (ELK Biotechnology, Wuhan, China) was used to synthesize cDNA according to the manufacturer’s instructions. Quantitative real-time PCR was performed using the StepOne™ Real-Time PCR (Life technologies, Wuhan, China) with specific primers (sequences were shown in Supplementary Table 1). The relative expression of RNAs was calculated using 2 − ΔΔCt method.

The mRNA levels of MCP-1 and MIP-2 were evaluated by qRT-PCR. Total RNA was extracted from kidney tissues using TRIpure Total RNA Extraction Reagent (ELK Biotechnology, Wuhan City, China) following the manufacturer’s protocol. First-strand cDNA was synthesized using the EntiLink™ 1st Strand cDNA Synthesis Kit (ELK Biotechnology, Wuhan City, China). Target gene expression levels were measured with EnTurbo™ SYBR Green PCR SuperMix (ELK Biotechnology, Wuhan City, China) using a StepOne™ RT-PCR thermocycler (Life Technologies, Massachusetts, USA). The mRNA levels of MCP-1 and MIP-2 were normalized to the β-actin mRNA level in the same sample and calculated using the Delta-Delta-CT method. The primer sequences were as follows: MCP-1, forward: 5′-GGCCTGTTGTTCACAGTTGCT-3′; reverse, 5′-GCCGACTCATTGGGATCATC-3′; MIP-2, forward: 5′-GTCAATGCCTGACGACCCTAC-3′, reverse: 5′-CCTTCCCAGGTCAGTTAGCCT-3′; and β-actin, forward: 5′- CGTTGACATCCGTAAAGACCTC-3′, reverse: 5′-TAGGAGCCAGGGCAGTAATCT-3′.

Total RNA was extracted using the TRIpure Total RNA Extraction Reagent method (ELK Biotechnology, China). The purified RNAs were analyzed using a Bioanalyser 2100. To confirm the expression of miR-146a-5p, miR-146a-5p was measured using the EntiLink™ 1st Strand cDNA Synthesis Kit (ELK Biotechnology, China) and EnTurbo™ SYBR Green PCR SuperMix (ELK Biotechnology, China). PCR was performed at 42°C for 60 min, 85°C for 5 min, and 40 cycles of amplification at 95°C for 10 s, 58°C for 30 s, and 72°C for 30 s. The melt curve stage was performed at 95°C for 30 s, 60°C for 30 min, and 95°C for 30 s. Relative changes in expression were determined using the 2-ΔΔCt formula and using U6 served as a reference gene. The sequences of the primers used were as follows: miR-146a-5p, forward, 5′-CCTGAGAAGTGAATTCCATGGG-3′ and reverse, 5′-CTCAACTGGTGTCGTGGAGTC-3′; U6, forward, 5′-CTCGCTTCGGCAGCACAT-3′ and reverse, 5′-AACGCTTCACGAATTTGCGT-3′.

TRIpure Total RNA Extraction Reagent (ELK Biotechnology, Wuhan, China) was used in accordance with the manufacturer’s instructions for isolation of total RNA from Pca tissues. Pellets containing RNA were rinsed with 75% ethanol, air-dried and resuspended in RNase inhibitor-containing RNase-free water (Thermo-Fisher-Scientific, Austria) for storage at -80°C. The concentration and purity of RNA were quantified by Agilent 2100 Bioanalyzer (Agilent Technologies Inc., USA) and sequencing libraries prepared using QIAseq miRNA Library Kit (QIAGEN, Germany) for sequencing with Illumina HiSeq2500. FastQC was employed to examine the quality of the microRNA sequencing reads by alignment with the human genome reference (GRCh38, Ensembl release 76) using FANSe3 with default parameter. miRNA expression was quantified with HTSeq v0.6.1p1 based on miRNA-base (https://www.miRNA-base.org/).

Total RNA was isolated with TRIpure Total RNA Extraction Reagent (ELK Biotechnology) and reverse transcription was conducted using EntiLink™ 1st Strand cDNA Synthesis Kit (ELK Biotechnology). After that, cDNA was subjected to qPCR using the EnTurbo™ SYBR Green PCR SuperMix kit (ELK Biotechnology) and analyzed with the StepOne™ Real-Time PCR System. The amplification conditions were as follows: 95°C for 3 min, 40 cycles of 95˚C for 10 sec, 58°C for 30 sec and 72°C for 30 sec. β-actin was employed as normalization controls. The 2^−ΔΔCt method was utilized for quantitation of gene expression. BCL6, forward: 5’- GCCCTATCCCTGTGAAATCTG-3’; reverse: 5’-GACGAAAGCATCAACACTCCAT-3’. av integrins, forward: 5’- GCTGGAACTCAACTCTTAGCTGG-3’; reverse: 5’- AGATGTGCTGAACAACTGGCC-3’. β3 integrins, forward: 5’- CTGTCCCTCATCCATAGCACC-3’; reverse: 5’- TAGAAGAACAGGCCACACGTG-3’. Actin, forward: 5’- GTCCACCGCAAATGCTTCTA-3’; reverse: 5’-TGCTGTCACCTTCACCGTTC-3’.