Im 31 microinjector

For bacterial infection, examples of gram-negative and -positive bacteria, Escherichia coli (strain ATCC25922) and Staphylococcus aureus (strain ATCC25923), respectively, were cultured to logarithmic phase at an absorbance (OD_600nm) of approximately 0.8 in Luria–Bertani (LB) broth at 37 °C. Bacterial cultures were resuspended to 1 × 10⁸ and 1 × 10⁹ colony-forming units/mL for E. coli and S. aureus, respectively. The 1-day-old wingless adults were anesthetized with CO₂ and placed on a fluted agar plate (1%), and each adult was injected at the dorsal site of the abdomen with 30 nL of E. coli or S. aureus solution using an IM-31 microinjector (NARISHIGE, Tokyo, Japan). The control group was injected with an equal volume of sterile water. Injected insects were placed in plastic cups on fresh tobacco leaves and raised in the above climate chamber. Then, 15 surviving individuals were randomly selected from each group at 6, 12, and 24 h post-injection for gene expression analysis, and each treatment was replicated three times.

We performed an RNAi experiment to investigate the function of SfIPPI in S. furcifera reproduction. Newly emerged (1–12 h) female adults of S. furcifera were selected as the test insects in this study. Following anesthetization with CO₂ for 30 s, we placed the test insects in empty culture plates. Then, we used an IM-31 microinjector (NARISHIGE, Tokyo, Japan) to inject 100 nL dsIPPI into the thorax between the middle and hind leg. An equal volume of dsGFP was injected in the negative control group. Three biological replicates were performed for each treatment, with 100 female adult injections for each replicate. The injected insects were placed in a test tube containing fresh rice seedlings and kept in an artificial climate chamber (temperature; 25 ± 1 °C; relative humidity, 70 ± 5%, and photoperiod, 16 h light: 8 h dark) for 48 h. Then, 10 of the surviving S. furcifera were randomly selected from each experimental group to determine RNAi efficiency using reverse transcription (RT)-qPCR. At the same time, the transcription levels of SfVg and SfVgR genes and JH synthesis pathway-related genes were determined to clarify their regulatory relationship. Three biological replicates were performed in this experiment, and 10 injected adults were used for each biological replicate.

Glass capillaries (GD-1; Narishige, Tokyo, Japan) were pulled into microinjection needles by using a vertical needle puller (PC-10; Narishige). These needles were used in an IM-31 microinjector (Narishige) equipped with a YOU-1 micromanipulator (Narishige). To generate PINK1-deficient zebrafish, guide RNA (target sequence: CCGGCCGGTACCGCTTCTTCAGG, 25 ng/μl) and Cas9 protein (0.6 μg/μl; New England Biolabs, Ipswich, MA) were mixed with phenol red (2%) and co-injected into one-cell stage fish embryos according to previous reports [34 (link),35 (link)]. The F1 generation and subsequent generations were genotyped using PCR (forward primer: GGTCCGTAAAAGCCTTCAGA, reverse primer: CTGGTTCTGTCCTCCTCCTG) and direct sequencing (sequencing primer: CTGGTTCTGTCCTCCTCCTG). Heterozygous mutant fish were crossed to obtain homozygous mutant (PINK1-KO) and control fish. For both genotypes, five fish per group were subjected to immunofluorescence studies at 4 months.