Total cellular RNA was extracted as described above. A minimum of two biological replicates were used per sample. Reverse transcription (RT) was conducted with the SuperScript II Kit (Invitrogen) according to the manufacturer's protocol. qPCR utilizing the KAPA SYBR FAST qPCR mix (KAPA Biosystems) was conducted with the QuantStudio® 7 Flex Real‐Time PCR System (Thermo Fisher Scientific). Primers for qRT–PCR are listed in Dataset EV8 .
Kapa sybr fast qpcr mix
Manufactured by Roche
Sourced in United States
KAPA SYBR FAST qPCR mix is a reagent used for quantitative real-time PCR (qPCR) applications. It contains a DNA polymerase, buffer, and SYBR Green I dye for detection of DNA amplification.
Automatically generated - may contain errors
Lab products found in correlation
Superscript 2 reverse transcriptase, by Thermo Fisher Scientific (3 mentions)
Trizol, by Thermo Fisher Scientific (3 mentions)
Cfx96 optical reaction module, by Bio-Rad (3 mentions)
C1000 touch thermal cycler, by Bio-Rad (2 mentions)
Oligo dt primer, by Thermo Fisher Scientific (2 mentions)
Superscript 2 kit, by Thermo Fisher Scientific (1 mentions)
Quantstudio 7 flex real time pcr system, by Thermo Fisher Scientific (1 mentions)
Quantstudio 5 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Veriti 96 well thermal cycler, by Thermo Fisher Scientific (1 mentions)
Pcr clean up column, by Qiagen (1 mentions)
Cfx96, by Bio-Rad (1 mentions)
Cfx384 touch real time pcr machine, by Bio-Rad (1 mentions)
Cfx96 real time system, by Bio-Rad (1 mentions)
Trizol protocol, by Thermo Fisher Scientific (1 mentions)
Fastquant rt kit with gdnase, by Tiangen Biotech (1 mentions)
Random hexamer, by Thermo Fisher Scientific (1 mentions)
Rnase free water, by Thermo Fisher Scientific (1 mentions)
Lightcycler 480, by Roche (1 mentions)
Protoscript 2 first strand cdna synthesis kit, by New England Biolabs (1 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (1 mentions)
12 protocols using kapa sybr fast qpcr mix
1
Quantitative Real-Time PCR Analysis
2
Reverse Transcription and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA or processed RNA was isolated using miRNeasy Mini Kit following the manufacturer's instructions. For regular cDNA synthesis, reverse transcription (RT) was performed in a 20-μl reaction containing RNA, 1 × RT buffer, 0.5 mM of each dNTP, 150 ng of random hexamers (11034731001, Roche) and maxima reverse transcriptase (RT) (EP0741, Thermo Fisher Scientific), and incubated at 25°C for 10 min followed by 30 min at 50°C; the RT enzyme was inactivated by heating at 85°C for 5 min (25 (link)). For qPCR analysis of circRNAs and mRNAs, 20-μl PCR reactions were set up with 0.1 μl of cDNA, 1 × KAPA SYBR® FAST qPCR mix (ABI Prism) (KK4605, KAPA Biosystems), and 250 nM gene-specific primers. The RT and PCR reactions were performed on Veriti® 96-Well Thermal Cycler (#4375786, Thermo Fisher Scientific, USA). QuantStudio 5 Real-Time PCR System (Thermo Fisher Scientific) with a cycle setup of 2 min at 95°C and 40 cycles of 2 s at 95°C plus 10 s at 60°C was used for RT-qPCR followed by calculation of the RNA fold change using the 2−ΔΔCT method (26 (link)).
3
Quantifying Gut Microbiota Strain Diversity
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
From mouse fecal pellets, DNA was extracted as previously described using phenol-chloroform extraction, precipitation in isopropanol, and further purification on a Qiagen PCR cleanup column (36 (link)). Purified DNA was then diluted 1:100 in nuclease-free water and used as the template for qPCR. Standard curves were generated from B. thetaiotaomicron att1::pNBU2_tet strains containing each of the three barcodes used. Cells for standard curve generation were grown overnight in TYG, pelleted, DNA extracted as described above, and quantified. Standard curves were generated with genomic DNA ranging from 100 to 0.0001 ng. qPCR was done using KAPA SYBR FAST qPCR Mix (KAPA KK4600). Absolute and relative abundance of each barcoded strain was calculated based on standard curves.
4
RT-qPCR Analysis of Ta-Lr34res Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Expression was determined by RT‐qPCR using a CFX96 or a CFX384 Touch Real‐time PCR machine (Bio Rad, Hercules (CA), USA). Reactions were set up with 5 μL KAPA SYBR fast qPCR mix (KAPA biosystems, Wilmington (MA), USA), Ta‐Lr34res primer (500 nm final concentration) (Risk et al., 2012 ) and 4 μL of 1:20 diluted cDNA per sample. GAPDH (Primers: Gapdh_Fw 5′CCGGGTTCCCACTGTGGAT3′ and Gapdh_Rw 5′TGACTAGCAACTCGGTGCGG3′; E = 102.0% R2 = 0.977 Slope = 3.466 y‐int = 21.012) and ADP (Gimenez et al., 2011 ) were used as reference genes. For each run, four technical replicates were used and four to seven biological replicates were used in all experiments.
5
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Samples were prepared as described above. Then mycelia were harvested and immediately frozen and ground into fine powder in liquid nitrogen. Total RNA was extracted and treated with DNase I to remove genomic DNA according to the standard TRIzol protocol (Invitrogen Corporation, Carlsbad, CA, United States). cDNA was prepared with a FastQuant RT Kit (with gDNase) (Tiangen, Beijing) according to the product’s instruction. qPCR was performed on a BIO-RAD CFX96TM Real-Time System (Bio-Rad, Hercules, CA, United States) with KAPA SYBR FAST qPCR mix (Kapa Biosystems, Wilmington, MA, United States) according to the product’s protocol. Each cDNA sample was analyzed in duplicate and at least three independent experiments were conducted. The average threshold cycle was used to calculate relative expression level according to 2-ΔΔCt method (Livak and Schmittgen, 2001 (link)). And the expression level was normalized to the level of β-tubulin. The primer pairs used for RT-qPCR assay were shown in Supplementary Table S1 .
6
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted according to manufacturer’s guidelines (TRIzol, Invitrogen) and the RNA pellet re-suspended in 30 μl of RNase free water (Ambion). 2 μg of RNA was reverse transcribed to cDNA using Superscript II Reverse Transcriptase (Invitrogen), random hexamers (Invitrogen) and oligo dT primers (Invitrogen) according to manufacturer’s protocol. RT-qPCR was performed on a C1000 TouchTM Thermal Cycler with the CFX96TM Optical Reaction Module (Bio-Rad) using KAPA SYBR FAST qPCR mix (Kapa Biosystems) in technical triplicates with gene specific-primers at a concentration of 500 nM. ΔCt was determined using β-actin as a reference gene and relative expression levels were plotted using the ΔΔCt method. Gene specific primers are listed in Table 1 .
7
Quantifying susC-like Transcripts in P. copri
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The preparation of P. copri cultures and extraction of total RNA were performed as described above. Reverse transcription was carried out with ProtoScript® II First Strand cDNA Synthesis Kit (New England Biolabs) using Random Primer Mix and 800 ng purified RNA as template for 20 µl reaction. The abundance of transcript for target susC‐like genes and reference tuf gene was quantified with KAPA SYBR® FAST qPCR mix (KAPA Biosystems) using 0.5 ng/µl template cDNA, 25 nM of each target gene‐specific primer. The reaction was performed in a 96‐well plate on the Roche Lightcycler 480. Using the ddCT method, raw values were normalized to values for the tuf gene and then the fold change was calculated by dividing MM+specific polysaccharide values by values obtained from MM+glucose.
8
RT-qPCR Analysis of Cavefish Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
cDNA was synthesised from 2 μg of RNA using Superscript II Reverse Transcriptase (Invitrogen) with random hexamers and oligo dT primers. RT-qPCR was performed on a C1000 Touch™ Thermal Cycler with the CFX96™ Optical Reaction Module (Bio-Rad) using KAPA SYBR FAST qPCR mix (Kapa Biosystems) in technical triplicates with gene specific-primers (see Supplementary information ) at a concentration of 500 nM. ΔCt was determined using rpl13α or EF1α as a reference gene and relative expression levels between surface and cavefish were compared directly using the ΔΔCt method
9
Reverse Transcription and qPCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from homogenized cells, tissues or embryos according to the manufacturer's guidelines (TRIzol, Invitrogen). RNA concentration was determined by NanoDrop2000 Spectrophotometer (Thermofisher) and integrity was determined by running 1 µl of RNA and 9 µl 11.1% glycerol on EtBr 1.5% agarose gel in 1 × TAE. cDNA was synthesized from 2 μg of RNA 2 µg of RNA was reverse transcribed to cDNA using Superscript II Reverse Transcriptase with random hexamers and oligo dT primers (all from Invitrogen).
RT-qPCR was performed on a C1000 Touch Thermal Cycler with the CFX96 Optical Reaction Module (Bio-Rad) using 2× KAPA SYBR FAST qPCR mix (Kapa Biosystems) in technical triplicates with gene specific-primers, see [19 (link),26 (link)], following cycling temperatures and times as per manufacturers protocol. ΔCt was determined using reference genes using rpl13α or EF1α as a reference gene and relative expression (RE) levels were compared using the ΔΔCt method.
RT-qPCR was performed on a C1000 Touch Thermal Cycler with the CFX96 Optical Reaction Module (Bio-Rad) using 2× KAPA SYBR FAST qPCR mix (Kapa Biosystems) in technical triplicates with gene specific-primers, see [19 (link),26 (link)], following cycling temperatures and times as per manufacturers protocol. ΔCt was determined using reference genes using rpl13α or EF1α as a reference gene and relative expression (RE) levels were compared using the ΔΔCt method.
10
Quantifying ErbB2 and Beta-actin mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was purified from frozen mouse tissues using the Total RNA Mini Kit (Geneaid). 0.5 mg sample was used as template for cDNA synthesis using M-MLV reverse transcriptase (Invitrogen). Real-time PCR was carried out (Rotorgene, Corbett Research) using KAPA SYBR FAST qPCR MIX (Kapa Biosystems) with the following primers (5′ to 3′): rat ErbB2 (neu) (Fw:AGGAGGACGAGTCCTTGTAGT, Rev: GCTCAGAGACCTGCTTTGGA); mouse B-act:(Fw: GGCTGTATTCCCCTCCATCG, Rev: CCAGTTGGTAACAATGCCATGT). mRNA was quantified using the ΔΔCt method.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!