Burkitt lymphoma cells (BL2) were cultured in RPMI medium 1640 (GIBCO) with 10% fetal calf serum (GIBCO), 10 000 U/ml penicillin and 10 mg/ml streptomycin (Gibco-BRL). LoVo cells were grown in 50% DMEM (GIBCO), 50% F12 (GIBCO) supplemented with 10% fetal calf serum and penicillin-streptomycin, 293T Lα were cultured in DMEM supplemented with 10% Tet System-approved fetal calf serum (Clontech), 300 μg/ml hygromycin B (Roche) and 100 μg/ml zeocin (InvivoGen). To abrogate MutLα expression, 50 ng/ml doxycyclin (Clontech) was added to the media. siRNA transfections were carried out using the calcium phosphate transfection. Synthetic siRNA oligonucleotides sequences (all 5′ to 3′) were as follows: siLuc sequence CGTACGCGGAATACTTCGATT, siMSH2 UCCAGGCAUGCUUGUGUUGAATT and MSH6 CGCCATTGTTCGAGATTTA (Microsynth).
Penicillin
Manufactured by Takara Bio
Sourced in China
Penicillin is a laboratory equipment used for the cultivation and isolation of penicillin-producing microorganisms. It provides a controlled environment for the growth and production of this important antibiotic compound.
Automatically generated - may contain errors
Lab products found in correlation
Streptomycin, by Takara Bio (10 mentions)
Penicillin, by Thermo Fisher Scientific (6 mentions)
Streptomycin, by Thermo Fisher Scientific (6 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (5 mentions)
Fetal bovine serum (fbs), by Takara Bio (4 mentions)
Lenti x 293t cells, by Takara Bio (3 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (2 mentions)
Skbr3, by American Type Culture Collection (2 mentions)
Mda mb 361, by American Type Culture Collection (2 mentions)
Mccoy s 5a medium, by Thermo Fisher Scientific (2 mentions)
Fetal calf serum (fcs), by Takara Bio (1 mentions)
Doxycyclin, by Takara Bio (1 mentions)
Fetal calf serum (fcs), by Thermo Fisher Scientific (1 mentions)
Dulbecco modified eagle medium (dmem), by Takara Bio (1 mentions)
Tet system approved fetal calf serum, by Takara Bio (1 mentions)
Rpmi 1640 medium, by Thermo Fisher Scientific (1 mentions)
Zeocin, by InvivoGen (1 mentions)
Hygromycin b, by Roche (1 mentions)
Hela tet off, by Takara Bio (1 mentions)
Hepg2, by American Type Culture Collection (1 mentions)
12 protocols using penicillin
1
Cell Culture and siRNA Transfection
2
Culturing Human Cancer Cell Lines
3
Fibroblast Response to TGF-β1 Treatment
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Normal human dermal fibroblasts were purchased (Clontech) and were grown in Dulbecco’s modified Eagle’s medium (DMEM, Nacalai tesque) containing 10% fetal bovine serum (FBS), 100 U/ml penicillin, and 100 μg/ml streptomycin (Nacalai tesque) at 37 °C in a humidified 5% CO2 atmosphere. When cells reached ~70% confluency they were starved in DMEM containing 0.1% FBS for 24 h and then pretreated with dimethyl sulfoxide (DMSO) as a control or 4.5 μM of DMSO-diluted LG283. The LG283 doses were optimized on the basis of sequential pilot experiments (data not shown). One-hour after stimulation cells were stimulated with 10 ng/ml human recombinant (r) TGF-β1 (Peprotech) for use in experiments of immunofluorescence staining, real-time reverse transcription-polymerase chain reaction (RT-PCR), and western blot analysis. Fibroblasts between passages 3 and 5 were prepared for all experiments.
4
Culturing Liver Cancer Cell Lines
5
HeLa Cell Culture and Maintenance
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HeLa cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM; Gibco) supplemented with 10% fetal bovine serum (FBS; Gibco), 2 mM L-glutamine (PAN-Biotech), 100 U/ml penicillin (PAN-Biotech), and 0.1 mg/ml streptomycin (PAN-Biotech). HeLa-TREx cell lines were maintained in DMEM supplemented with 10% tetracyclin-free FBS (Clontech), 2 mM L-glutamine, 100 U/ml penicillin, and 0.1 mg/ml streptomycin. For HeLa-TREx cells, 5 µg/ml blasticidin (Invitrogen) and 100 µg/ml zeocin (Invitrogen) were added to the medium to maintain expression of the Tet repressor and YFP-fused TIAR. All cells were cultured at 37°C in 5% CO2. ANI (Sigma-Aldrich) was used at 0.1 µg/ml, CHX (Roth) at 100 µg/ml, and HT (Sigma-Aldrich) at 2 µg/ml. SB202190, SB203580, and SP600125 (all Sigma-Aldrich) were used at 10 µM.
6
Culturing the INS-1 Rat Insulinoma Cell Line
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The rat insulinoma cell line INS-1 was obtained from the China Center for Type Culture Collection (Wuhan University, Wuhan, China). RPMI-1640 cell culture medium and fetal bovine serum (FBS) were purchased from HyClone (GE Healthcare Life Sciences, Logan, UT, USA).
INS-1 cells were maintained in RPMI-1640 medium containing 11 mM glucose supplemented with 10% (v/v) heat-inactivated FBS, 100 U/ml penicillin, 100 U/ml streptomycin, 10 mM HEPES, 1 mM sodium pyruvate and 50 µM β-mercaptoethanol (all Takara Biotechnology Co., Ltd., Dalian, China). Culture medium was replaced daily until cell confluency reached 80–90%.
INS-1 cells were maintained in RPMI-1640 medium containing 11 mM glucose supplemented with 10% (v/v) heat-inactivated FBS, 100 U/ml penicillin, 100 U/ml streptomycin, 10 mM HEPES, 1 mM sodium pyruvate and 50 µM β-mercaptoethanol (all Takara Biotechnology Co., Ltd., Dalian, China). Culture medium was replaced daily until cell confluency reached 80–90%.
7
Culturing HT1080 Fibrosarcoma Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human HT1080 fibrosarcoma cells55 (link) were obtained from the American Type Culture Collection (ATCC, Rockville, MD). The cells were routinely cultured in DMEM (Gibco, Waltham, MA) supplemented with 1% penicillin, 1% streptomycin, and 8% tetracycline-free foetal bovine serum (FBS) from Takara (Japan; Cat# 631106). Other human cell lines used in this study are described in the Supplemental Information (Supplementary Fig. 3 ).
8
Culturing Rat Cardiac H9c2 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Rat cardiac H9c2 cells (ATCC, USA) were cultured in Dulbecco's modified Eagle's media (DMEM) (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany), which is supplemented with 10% fetal bovine serum (FBS; Takara Biotechnology Co., Ltd., Dalian, China), 100 ug/ml streptomycin (Takara Biotechnology Co., Ltd.), and 100 unit/ml penicillin (Takara Biotechnology Co., Ltd.) at 37°C in a humidified atmosphere with 5% CO2.
9
Cell Culture Conditions for MM1S, RPMI8226, and Heca452
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The MM1S and RPMI8226 cell lines were from the American Type Culture Collection (ATCC; Manassas, VA). The Heca452 enriched cell lines were generated from the parental lines as previously described25 (link). Cells were cultured in RPMI1640 media supplemented with 10% heat inactivated foetal bovine serum (hiFBS), 50 U/ml penicillin and 50 µg/ml streptomycin, all from Merck Millipore (Rahway, NJ). Lenti-X™ 293 T cells were from TaKaRa (Shiga, Japan) and maintained in Dulbecco’s modified eagle media (DMEM) supplemented with 10% hiFBS, 50 U/ml penicillin and 50 µg/ml streptomycin. All reagents are from Merk Millipore unless stated otherwise.
10
PD-1/PD-L1 Blockade Assay for NSCLC Cell Lines and TILs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The NSCLC cell lines H1650, H23, A549, H460, and H1299 were obtained from the American Type Culture Collection (Manassas, VA) and cultured in complete RPMI 1640 medium with 10% fetal bovine serum (FBS), 100 U/mL penicillin, and 100 mg/mL streptomycin (Gibco, Carlsbad, CA). Blood mononuclear cells were thawed into RPMI-1640 medium supplemented with 10% FBS, 100 U/mL penicillin, 100 mg/mL streptomycin, 50 IU/mL recombinant human interleukin-2 (IL-2), and 1% (10 mg/mL) DNase (Takara Bio, Kusatsu, Japan). TILs were washed and cultured in RPMI-1640 medium supplemented with 10% FBS containing IL-2 (100 U/mL). After 3 days the expanded TILs were extensively washed and fed with IL-2-containing medium for 6 days. For the PD-1/ PD-L1 blockade assay, the TILs and PB mononuclear CD8-positive T cells were cultured (1Â10 5 per well) with 10 mg/mL anti-PD-1 (clone MIH4, eBioscience, San Diego, CA), anti-PD-L1 (clone MIH1, eBioscience), and their isotype control immunoglobulin G (IgG) (eBioscience). After 96 hours, the cells were collected and analyzed by FCM.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!