Stemmacs ips brew xf media

A single guide RNA targeting PFKFB3 was designed using the CRISPR Finder online tool (Wellcome Sanger Institute Genome Editing) and cloned into a mammalian expression vector encoding Cas9 from S. pyogenes and a puromycin resistance gene (Addgene, 62988) using the Golden gate reaction^{54 (link)}. The following primers were used for PFKFB3 guide RNA cloning: PFKFB3 F: CACCGGCCCACCATGACGATGACGG
PFKFB3 R: AAACCCGTCATCGTCATGGTGGGCC
The sgRNA vector was confirmed by Sanger sequencing and transfected into iPS cells using Lipofectamine 3000. In brief, 5 µg of plasmid were transfected into iPS cells seeded on matrigel-coated six-well plates in StemMACS iPS Brew-XF media (Miltenyi Biotech, 130-104-368) supplemented with 10 μM Y-27632 for 24 h. The following day, the transfection complexes were removed and fresh StemMACS iPS Brew-XF media supplemented with 10 μM Y-27632 was added to the cells. Puromycin selection (0.2 µg/ml) was performed for 48 h and single cells were cultured for an additional ten days. Single colonies representing isogenic mutant lines were selected and expanded. Knockout cell lines were verified by Sanger sequencing and western blot analysis. Two independent knockout clones (P206, P208) were used for this study.

hiPSCs were cultured and maintained undifferentiated in a chemically defined growth medium (StemMACS™ iPS-Brew XF media; Miltenyi Biotec, Paris, France) onto growth-factor-reduced Matrigel (BD Biosciences, Franklin Lakes, NJ, US)-coated plates (8.6 μg/cm²). In short, when reaching 70–80% confluency, hiPSCs were treated with an enzyme-free solution (hereafter referred to as gentle dissociation solution) containing 0.5 mM EDTA (Lonza, Basel, Switzerland), D-PBS (Gibco Life Technologies, Scotland, UK) and 1.8 mg/mL NaCl (Sigma-Aldrich, st Louis, MO, USA). hiPSCs were incubated for 2 min in gentle dissociation solution at 37 °C, and the colonies were dispersed to small clusters and lifted carefully using a 5 mL glass pipette at a ratio of 1:3 or 1:4 for further amplification. When necessary, differentiated areas were removed from hiPSC cultures prior to passaging, in order to maintain the cultures as undifferentiated before proceeding to their differentiation. hiPSC lines were maintained in an incubator (37 °C, 5% CO₂) with daily medium changes.