Cuso4 5h2o
CuSO4·5H2O is a chemical compound that consists of copper sulfate pentahydrate. It is a blue crystalline solid that is soluble in water. This compound is commonly used in various laboratory applications.
Lab products found in correlation
26 protocols using cuso4 5h2o
Copper Stress Response in Salvia miltiorrhiza
Synthesis of Platinum and Iridium Catalysts
Hepatocyte Maintenance Medium Formulation
Synthesis of Copper(II) Sulfate Compound
DNA-Templated Copper Nanocluster Synthesis
Oligo A: TTTCGTCATGGGTTGACGTTT Oligo B: CGTCAACCCATGACG Exonuclease III and sodium ascorbate were purchased from Sangon Biotech Co., Ltd. (Shanghai). CuSO4•5H2O, Hg(NO3)2, and MgCl2 were purchased from Sinopharm Chemical Reagent Co., Ltd. (Shanghai, China). Disodium hydrogen phosphate dodecahydrate (Na2HPO4•12H2O), sodium dihydrogen phosphate (NaH2PO4•2H2O), and sodium nitrate (NaNO3) were purchased from Aldrich Chemical Co. We prepared phosphate-buffered saline (PBS) (20 mM, pH 7.4) from 3.58 g Na2HPO4•12H2O, 1.56 g NaH2PO4•2H2O, and 1.7 g NaNO3 in one liter ultrapure water.
Comparing Inorganic and Organic Copper Diets
Comparing Inorganic and Organic Copper Diets
Generation of hiHep Cells from Fibroblasts
Synthesis of Metal Oxide Nanostructures
Copper Sulfate Induced Oxidative Stress
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!