The largest database of trusted experimental protocols

26 protocols using cuso4 5h2o

1

Copper Stress Response in Salvia miltiorrhiza

Check if the same lab product or an alternative is used in the 5 most similar protocols
Salvia miltiorrhiza was cultivated at 25°C with a 16-h-light/8-h-dark cycle in MS basal medium containing 3% sugar and 8% agar. CuSO4·5H2O (Sinopharm Chemical Reagent Company., Ltd, China) was dissolved in distilled water to make concentrations of 5, 25, and 100 mM. All the prepared CuSO4·5H2O were sterilized through 0.22-μm filters and then added to MS basal medium to a final concentration of 5, 25, or 100 μM. S. miltiorrhiza was treated with different concentrations of CuSO4·5H2O for 5 days, and then plant matter was collected for the following experiments.
+ Open protocol
+ Expand
2

Synthesis of Platinum and Iridium Catalysts

Check if the same lab product or an alternative is used in the 5 most similar protocols
SiO2 and H2PtCl6·6H2O were acquired from Aladdin, and the Na3IrCl6 was supplied from Alfa Aesar. Other reagents used in this work, including glucose, methanol, WO3, NaOH, CuSO4·5H2O and NaIO3 were of analytical reagent grade and obtained from Sinopharm Chemical Reagent Co., Ltd. All of the above chemicals were used without further purification.
+ Open protocol
+ Expand
3

Hepatocyte Maintenance Medium Formulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Hepatocyte maintenance medium (HMM) is DMEM/F12 (Gibco) supplemented with 0.544 mg/L ZnCl2 (Sinopharm), 0.75 mg/L ZnSO4·7H2O (Sinopharm), 0.2 mg/L CuSO4·5H2O (Sinopharm), 0.025 mg/L MnSO4 (Sinopharm), 2 g/L Bovine serum albumin (Sigma-Aldrich), 2 g/L Galactose (Sigma-Aldrich), 0.1 g/L Ornithine, 0.03 g/L Proline, 0.61 g/L Nicotinamide, 1× Insulin-transferrin-sodium selenite media supplement (Sigma-Aldrich), 40 ng/mL TGFα (Peprotech), 40 ng/mL EGF (Peprotech), 10 µM dexamethasone, 10 µM Y-27632 (MCE), 0.5 µM A-83-01 (Tocris), 3 µM CHIR99021 (Sigma-Aldrich).
+ Open protocol
+ Expand
4

Synthesis of Copper(II) Sulfate Compound

Check if the same lab product or an alternative is used in the 5 most similar protocols
CuSO4·5H2O, L-serine, olivetol, sodium hydroxide, paraffin oil, and graphite were obtained from Sinopharm Chemical Reagent Co., Ltd. (Shanghai, China). The double distilled water was supplied for the preparation of aqueous solutions in experiments. All reagents were of analytical grade and used as received.
+ Open protocol
+ Expand
5

DNA-Templated Copper Nanocluster Synthesis

Check if the same lab product or an alternative is used in the 5 most similar protocols
All DNA oligonucleotides used for synthesis of copper nanoclusters were purchased from Sangon Biotech Co., Ltd. (Shanghai, China). The sequences of the DNA oligonucleotides were as follows:
Oligo A: TTTCGTCATGGGTTGACGTTT Oligo B: CGTCAACCCATGACG Exonuclease III and sodium ascorbate were purchased from Sangon Biotech Co., Ltd. (Shanghai). CuSO4•5H2O, Hg(NO3)2, and MgCl2 were purchased from Sinopharm Chemical Reagent Co., Ltd. (Shanghai, China). Disodium hydrogen phosphate dodecahydrate (Na2HPO4•12H2O), sodium dihydrogen phosphate (NaH2PO4•2H2O), and sodium nitrate (NaNO3) were purchased from Aldrich Chemical Co. We prepared phosphate-buffered saline (PBS) (20 mM, pH 7.4) from 3.58 g Na2HPO4•12H2O, 1.56 g NaH2PO4•2H2O, and 1.7 g NaNO3 in one liter ultrapure water.
+ Open protocol
+ Expand
6

Comparing Inorganic and Organic Copper Diets

Check if the same lab product or an alternative is used in the 5 most similar protocols
Three isonitrogenous (~ 42.5 % crude protein) and isolipidic (~ 8.5 % crude lipid) experimental diets were formulated to contain the same dose of two different forms of copper (inorganic, diet I-Cu; organic, diet O-Cu) in comparison to a control diet with no supplemental copper (diet C-Cu). Thus, 40 mg kg -1 CuSO4•5H2O (Cu content = 25.6 %; Sinopharm Chemical Reagent Co., Ltd., Shanghai, China) and copper amino acid chelate (Cu content = 10.9 %; Zinpro Corp., USA) were added to the control (unsupplemented) diet, with the analyzed values of Cu being 12.4, 49.8 and 50.0 mg kg -1 in C-Cu, I-Cu and O-Cu diets, respectively. The formulations and proximate compositions of the experimental diets are shown in Table S1. The diets were prepared following the protocol described in detail previously (Shi et al., 2020) (link). The experimental diets were sealed in vacuum-packed bags and stored at -20 °C until used in the feeding trial.
+ Open protocol
+ Expand
7

Comparing Inorganic and Organic Copper Diets

Check if the same lab product or an alternative is used in the 5 most similar protocols
Three isonitrogenous (~ 42.5 % crude protein) and isolipidic (~ 8.5 % crude lipid) experimental diets were formulated to contain the same dose of two different forms of copper (inorganic, diet I-Cu; organic, diet O-Cu) in comparison to a control diet with no supplemental copper (diet C-Cu). Thus, 40 mg kg -1 CuSO4•5H2O (Cu content = 25.6 %; Sinopharm Chemical Reagent Co., Ltd., Shanghai, China) and copper amino acid chelate (Cu content = 10.9 %; Zinpro Corp., USA) were added to the control (unsupplemented) diet, with the analyzed values of Cu being 12.4, 49.8 and 50.0 mg kg -1 in C-Cu, I-Cu and O-Cu diets, respectively. The formulations and proximate compositions of the experimental diets are shown in Table S1. The diets were prepared following the protocol described in detail previously (Shi et al., 2020) (link). The experimental diets were sealed in vacuum-packed bags and stored at -20 °C until used in the feeding trial.
+ Open protocol
+ Expand
8

Generation of hiHep Cells from Fibroblasts

Check if the same lab product or an alternative is used in the 5 most similar protocols
hiHep cells were generated as previously described22 (link). Briefly, 2×105 human dermal fibroblasts between passage 5 and 10 were seeded on a collagen-I-coated 60 mm dish and infected with pWPI lentiviruses expressing FOXA3, HNF1A and HNF4A (multiplicity of infection: 1.5 for each virus). For lentivirus production, pWPI lentiviral plasmids encoding FOXA3, HNF1A or HNF4A were introduced into 293FT cells (Thermo) together with psPAXs (Addgene) and pMD2.G (Addgene). The medium containing lentiviruses was collected and passed through 0.45 μm filter (Sangon Biotech) after 48 hours incubation. After 48 hours’ infection of human dermal fibroblasts, the medium was changed to hepatocyte maintenance medium (DMEM/F12 (Gibco) supplemented with 0.544 mg/L ZnCl2 (Sinopharm), 0.75 mg/L ZnSO4·7H2O (Sinopharm), 0.2 mg/L CuSO4·5H2O (Sinopharm), 0.025 mg/L MnSO4 (Sinopharm), 2 g/L Bovine serum albumin (Sigma-Aldrich), 2 g/L Galactose (Sigma-Aldrich), 0.1 g/L Ornithine (Alfa Aesar), 0.03 g/L Proline (Alfa Aesar), 0.61 g/L Nicotinamide (Solarbio), 1X Insulin-transferrin-sodium selenite media supplement (Sigma-Aldrich), 40 ng/ml TGFα (PeproTech), 40 ng/ml EGF (PeproTech), and 10 μM dexamethasone (Sigma-Aldrich)). Cells were collected for further analyses at different time points according to specific experiment.
+ Open protocol
+ Expand
9

Synthesis of Metal Oxide Nanostructures

Check if the same lab product or an alternative is used in the 5 most similar protocols
Bi(NO3)3·5H2O(≥99.0%), NH4VO3(≥99.0%), NaCl(≥ 99.8%), NH3·H2O(~28%), HNO3(~68%), HBO3(≥99.8%), KOH(≥85.0%), Na2SO3(≥ 97.0%), Co(NO3)2·6H2O (≥98.5%), KMnO4(≥ 99.5%), SrCO3(≥99%), TiO2(≥99%), Rh2O3(≥ 99.8%), RuCl3·nH2O(≥98%), K2CrO4(≥98%), polyvinyl alcohol(≥99%), Zn(NO3)2·6H2O(≥99%), Na2WO4·2H2O(≥99.5%), HCl(36.0~38.0%), (NH4)2C2O4·H2O(≥99.8%), CuSO4·5H2O(≥99%), lactic acid, NaOH(≥96%), and TiCl4(≥98.0%) were purchased from Sinopharm Chemical Reagent Co., Ltd. ZnO (99.9%), Cu2O(99.9%), WO3 (≥99.0%) and low-melting-point liquid metal (bismuth indium tin ingot/Field’s metal, Bi: In: Sn = 32.5: 51: 16.5 wt%) is purchased from Thermo Fisher Scientific Inc. All chemicals were used without further purification.
+ Open protocol
+ Expand
10

Copper Sulfate Induced Oxidative Stress

Check if the same lab product or an alternative is used in the 5 most similar protocols
CuSO4·5H2O was purchased from Sinopharm Chemical Reagent Co., Ltd. (Shanghai, China). Sodium dodecyl sulfonate (SDS), aprotinin, leupeptin, pepstatin A, and phenylmethylsulfonyl fluoride (PMSF) were obtained from AMRESCO Inc. (Solon, OH, USA). Cell Counting Kit-8 (CCK-8) was purchased from Med. Chem. Express (Shanghai, China). Superoxide dismutase (SOD), catalase (CAT), and 4-phenylbutyric acid (4-PBA) (purity ≥ 98%) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Dulbecco’s modified Eagle’s medium (DMEM) and fetal bovine serum (FBS) were purchased from Life Technologies Corporation (Grand Island, NY, USA). 2′,7′-dichlorofluorescein-diacetate (DCFH-DA) and 0.25% Trypsin-EDTA were purchased from Beyotime Biotechnology (Haimen, China). All other chemicals were of analytical grade.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!