Log In Sign up
The largest database of trusted experimental protocols

7500 fast detection system

Manufactured by Thermo Fisher Scientific
Visit Supplier
Sourced in United States

The 7500 Fast detection system is a real-time PCR instrument designed for rapid and accurate nucleic acid detection. It provides fast thermal cycling capabilities to enable quick sample processing and analysis. The system is capable of performing qualitative and quantitative real-time PCR assays, supporting a range of sample types and detection chemistries.

Automatically generated - may contain errors

Lab products found in correlation

High capacity rna to cdna kit, by Thermo Fisher Scientific (1 mentions) Aurum total rna mini kit, by Bio-Rad (1 mentions) Perfecta sybr green fastmix, by Quanta Biosciences (1 mentions) Iscript cdna synthesis kit, by Bio-Rad (1 mentions) Taqman assay, by Thermo Fisher Scientific (1 mentions) Rneasy kit, by Qiagen (1 mentions) Syber green pcr master mix, by Thermo Fisher Scientific (1 mentions) Rneasy mini kit, by Qiagen (1 mentions) M mlv reverse transcriptase, by Promega (1 mentions) 7500 software v2, by Thermo Fisher Scientific (1 mentions) Nanodrop onec uv vis spectrophotometer, by Thermo Fisher Scientific (1 mentions)

Spelling variants of this product

7500 system (124 citations) 7500 Fast (121 citations) 7500 Fast system (119 citations) ABI 7500 Fast Sequence Detection System (56 citations) Prism 7500 Fast Sequence Detection System (20 citations) Applied Biosystems 7500 Fast Sequence Detection System (9 citations) ABIPrism 7500 Fast sequence detection PCR system software (3 citations) 7500 fast real-time detection system (2 citations) Applied Biosystems 7500 Fast real-time detection system (2 citations) Prism 7500 Fast Sequence Detection System 2.2 (2 citations)

7 protocols using 7500 fast detection system

1

Quantification of miRNA-182-5p in CML

Check if the same lab product or an alternative is used in the 5 most similar protocols
In brief, total RNA was isolated from CML cells using Trizol method following the manufacturer's instructions. An amount of 20 ng RNA was used to synthesize a specific cDNA of hsa-miRNA182-5p using stem-loop miRNA specific RT primer. qRT-PCR was performed using Sybr green dye (purchased from Kappa, Boston, MA, USA) on Applied Biosystems 7500 fast detection system (Carlsbad, CA, USA). Expression of miRNA was normalized using the expression of the housekeeping genes 18 s r-RNA. Relative quantification of miRNAs was calculated with the delta delta ΔΔCt method. Data are shown as mean of three independent experiments. Error bars represent s.e. of three independent experiments with P-values of the mean. *P<0.05, **P<0.01 and ***P<0.001. The Bcr-Abl/Abl ratio was determined for each patient sample (Supplementary Table 1).
Arya D., Sachithanandan S.P., Ross C., Palakodeti D., Li S, & Krishna S. (2017). MiRNA182 regulates percentage of myeloid and erythroid cells in chronic myeloid leukemia. Cell Death & Disease, 8(1), e2547-.
+ Open protocol
+ Expand
2

Quantitative Real-Time PCR Analysis

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
First-strand complementary DNA (cDNA) was synthesized from ~2 μg of extracted total RNA using High Capacity RNA-to-cDNA Kit (Applied Biosystems, Paisley, UK). TaqMan fluorogenic probes for the specific gene were from Applied Biosystems (Thermo Fisher Scientific, Waltham, MA, USA) and all quantitative reverse transcriptase–PCR reactions were performed using Applied Biosystems 7500 Fast detection system. The relative mRNA expression was normalized against the housekeeping gene (GAPDH) and analyzed using 2−ΔΔCT equation as previously described (4 (link)). Quantitative Real-Time PCR data were presented as mean of triplicates ± SD of three independent experiments.
Barnawi R., Al-Khaldi S., Bakheet T., Fallatah M., Alaiya A., Ghebeh H, & Al-Alwan M. (2020). Fascin Activates β-Catenin Signaling and Promotes Breast Cancer Stem Cell Function Mainly Through Focal Adhesion Kinase (FAK): Relation With Disease Progression. Frontiers in Oncology, 10, 440.
+ Open protocol
+ Expand
3

HSV-1 Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
HCT116 (parental (p53+/+) and p53 knock-out (p53−/−)) and HeLa cells were seeded at 6×105 cells per 60 mm plate and infected with HSV-1 at moi of 1. Total RNA were extracted using an Aurum total RNA Mini kit (Bio-Rad, Hercules CA) according to the manufacturer’s instructions. First-strand cDNA were synthesized from 2.0 µg total RNA using an iScript cDNA synthesis kit (Bio-Rad Laboratories, Hercules CA) according to the manufacture’s protocol. Two µl of each cDNA synthesis reaction was used as template in 20 µl PCR reactions containing 10 µl PerfeCTa SYBR Green FastMix (Quanta biosciences, Gaithersburg, MD) and 1 µl primers (18 µM). Reactions were performed in 96-well PCR plates using a 7500 Fast detection system (Applied Biosystems Inc., Foster City CA). Reactions were performed with the following primer pairs: human glyceraldehyde phosphate dehydrogenase forward primer 5' ACAACTTTGGTATCGTGGAAGGAC and reverse primer 5' CAGGGATGATGTTCTGGAGAGC; HSV-1 ICP4 forward primer 5' CGACACGGATCCACGACCC and reverse primer 5' GATCCCCCTCCCGCGCTTCGTCCG; HSV-1 UL29 forward primer 5' GTGTTGGGGTTGAGCATCAG-3' and reverse primer 5' TCCGCCGCCGAGGTTC-3'. All results were normalized to the activity observed with human glyceraldehyde phosphate dehydrogenase.
Hsieh J.C., Kuta R., Armour C.R, & Boehmer P.E. (2014). Identification of two novel functional p53 responsive elements in the Herpes Simplex Virus-1 genome. Virology, 460-461, 45-54.
+ Open protocol
+ Expand
4

Quantification of PD-L1 mRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Sorted cells (PD-L1hi and PD-L1lo) were washed in 1 ml PBS by centrifugation (12,000 RPM) for 5 min at 4°C. RNA was then extracted from sorted cells using Qiagen RNeasy kit. Measuring PD-L1 mRNA level was performed to validate the sorting results. Gene expression measured by qPCR was performed using Predesigned TaqMan™ assays (supplementary table 4) and Applied Biosystems 7500 Fast detection system. The mRNA relative expression was measured relative to GAPDH, analyzed using 2−ΔΔCT equation and normalized against the control sample (PD-L1lo).53
Mansour F.A., Al-Mazrou A., Al-Mohanna F., Al-Alwan M, & Ghebeh H. (2020). PD-L1 is overexpressed on breast cancer stem cells through notch3/mTOR axis. Oncoimmunology, 9(1), 1729299.
+ Open protocol
+ Expand
5

Quantifying TRAIL-R Expression in Murine Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was extracted using the RNeasy Mini Kit from Qiagen (Les Ulis, France). M-MLV Reverse Transcriptase (Promega, Charbonnières, France) was used to synthesize cDNAs from total RNA. Real-time PCR was performed in triplicate using the syber green PCR master Mix from Applied Biosystems (Courtaboeuf, France) and analyzed using the 7500 Fast Detection System (Applied Biosystems). Specific forward and reverse primers were: murine TRAIL-R, 5′-CCT CTC GGA AAG GGC ATT C-3′ and 5′-TCC TGCTCGATG ACC AGC T-3′7 (link) and murine cyclophilin A, used as a standardizing control, 5′-GGCCGA TGA CGA GCC C-3′ and 5′-TGT CTT TGG AAC TTT GTC TGC AA-3′.
Dufour F., Rattier T., Shirley S., Picarda G., Constantinescu A.A., Morlé A., Zakaria A.B., Marcion G., Causse S., Szegezdi E., Zajonc D.M., Seigneuric R., Guichard G., Gharbi T., Picaud F., Herlem G., Garrido C., Schneider P., Benedict C.A, & Micheau O. (2017). N-glycosylation of mouse TRAIL-R and human TRAIL-R1 enhances TRAIL-induced death. Cell Death and Differentiation, 24(3), 500-510.
+ Open protocol
+ Expand
6

Quantitative PCR Protocol for Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
qPCR was performed in a 96-well format on 100ng of cDNA (20ng/uL) with 1uL of TaqMan Gene Expression Assay (20X) and 10uL of TaqMan Gene Expression Master Mix (2X) in a final volume of 20uL. Each sample was tested in triplicate. All assays were run on Applied Biosystems 7500 Fast detection system using standard setting (10 min incubation at 95°C, followed by 40 cycles at 95°C for 15 seconds and 60°C for 1 minute). Absolute values (mRNA copies/ng of cDNA) were derived from a standard curve generated with a serial dilution of plasmid containing the cloned sequence of the target gene. Each target standard curve demonstrated linearity with regression coefficients (r2 values) above 0.997. All assays had efficiency between 88–100% with a standard curve slope between −3.3 to −3.6. Data were extracted with 7500 Software V2.0.5 (Life Technologies, Grand Island, NY, USA).
Forest A., Amatulli M., Ludwig D.L., Damoci C.B., Wang Y., Burns C.A., Donoho G.P., Zanella N., Fiebig H.H., Prewett M.C., Surguladze D., DeLigio J.T., Houghton P.J., Smith M.A, & Novosiadly R. (2015). Intrinsic Resistance to Cixutumumab is Conferred by Distinct Isoforms of the Insulin Receptor. Molecular cancer research : MCR, 13(12), 1615-1626.
+ Open protocol
+ Expand
7

Quantitative RT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated using TRIzon® reagent from gastric tissues (cat. no.CW0580; CoWin Biosciences) and was quantified using a NanoDrop OneC UV–Vis Spectrophotometer (Thermo Fisher Scientific, Inc.). Complementary DNA (cDNA) was synthesized using a HiFiScript cDNA Synthesis Kit (cat. no. CW2569M; CoWin Biosciences) according to the manufacturer's protocol. qPCR was performed using an UltraSYBR Mixture (Low ROX) kit following the manufacturer's instructions (cat. no. CW2601M; CoWin Biosciences) on a 7500 Fast detection system (Applied Biosystems; Thermo Fisher Scientific, Inc.). qPCR was performed in a 20 µl reaction system consisting of ~50 ng cDNA, 10 µl UltraSYBR Mixture (Low ROX) and 0.2 µM forward and reverse primers for each target. qPCR was performed using the following thermocycling conditions: Initial denaturation at 95°C for 10 min, followed by amplification for 40 cycles (denaturation at 95°C for 15 sec and annealing and extension at 60°C for 1 min). The relative mRNA expression levels were analyzed using the 2−ΔΔCq method (42 (link)) and were normalized to β-actin. The primers used in the present study are presented in Table I.
Zong C., Yang M., Guo X, & Ji W. (2022). Chronic restraint stress promotes gastric epithelial malignant transformation by activating the Akt/p53 signaling pathway via ADRB2. Oncology Letters, 24(3), 300.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!