Ab4729

ChIP was carried out as described (25 (link)). Briefly, K562 cells (2 × 10⁷) were cross-linked with 1% formaldehyde and then nuclei were isolated by cell lysis. MNase digestion and sonication were performed with nuclei to produce chromatin at a mononucleosome size. Fragmented chromatin was incubated with antibodies after pre-clearing. Protein–DNA complexes were recovered with protein A or G agarose beads, and DNA was purified after reverse cross-linking.
Antibodies used in this study were purchased from Santa Cruz Biotechnology for TAL1 (sc-12984), GATA-1 (sc-1233), p45/NF-E2 (sc-22827), Brg1 (sc-10768), CBP (sc-369), Pol II (sc-899) and Ldb1 (sc-11198), from Millipore for H3ac (06-599), H3K4me2 (07-030 (link)) and H3K27me2 (07-452), from Abcam for H3K27ac (ab4729), H3K36me3 (ab9050), Rad21 (ab992) and SMC3 (ab9263) and from R&D systems for LMO2 (AF2726). Normal rabbit IgG (sc-2027) and goat IgG (sc-2028) were purchased from Santa Cruz Biotechnology.

ChIP assays were performed according to the published protocol^{39 (link)}. The chromatin was sheared on the Sonics VCX-130 with 15 s on, 30 s off, 12 cycle. Immunoprecipitation was performed using 3–5 μg of antibodies (GR, Santa Cruz Biotechnology, sc1003X; H3K27ac, Abcam, ab4729; ZBTB16, R&D Systems, MAB2944). DNA was purified by DNA Clean & Concentrator-5 kit (ZYMO). Libraries were constructed for ChIP samples on GR or H3K27ac with NEBNext Ultra DNA Library Prep Kit for Illumina (E7370), and sequenced on HiSeq4000 by Annoroad Gene Tech. (Beijing) Co., Ltd. Two biological replications were carried out for each condition. ChIP sample on ZBTB16 was used for qPCR with the primer at the promoters of SYNPO (forward: CATGAGTGGGGAAACTGCAC; reverse: AGAGAGGTCTGAGGTTTGGC). Three biological replications were carried out.